Question
please explain
Mailings Review View ferences av A. A AaBbCcDdEe 211 av AalbCcDdte AaBbCcD AaBbCcDdE AaB No Spacing Heading 1 Heading 2 Title
. A UN Normal No Spacing Heading 1 DAS 21.) Original template strand: 3 TAC GCA AGC AAT ACC GAC GAA S Mutation Describe wha
0 0
Add a comment Improve this question Transcribed image text
Answer #1

2. In both prokaryotes and eukaryotes, genes are controlled by various factors and chemicals.

In both, genes are not active always. the genes are switched on and off to control the expression of the genes.

The difference between pro and eukaryotic genes regulation are---

In prokaryotes, genes are arranged in to operons and regulated. Where as in Eukaryotes, genes present on DNA are coiled around histone proteins. They are regulated by methylation, acetylation etc.

In prokaryotes, both transcription and translation occurs in the cytoplasm and regulation occurs in transcriptional level. Where as in eukaryotes, transcription occurs in nucleus and translation occurs in cytoplasm. Regulation occurs in transcriptional level and also translational level.

3. Advantage of alternate splicing is one mRNA can be used to produce different proteins by splicing different introns and keeping different exons.

4. Mutations---

Substitution of T for G at position 8:

3' TAC GCA ATC AAT ACC GAC GAA 5'

Here a pyramidine is replaced by purine. It is a point mutation and Transversion mutation. The mutation leads to change in amino acid from Serine to Stop codon.

Addition of T between 8 and 9.

3' TAC GCA AGT CAA TAC CGA CGA A 5'

Because of the addition, frame shift mutation occurs.

Aminoacid sequence changed from the region of addition to --Ser, Val, met, Ala, Ala.

Substitution of A for C at 15.

3' TAC GCA AGC AAT ACA GAC GAA 5'

Substitution of adenine in place of cytosine will result in change of amino acid from Trp to Cytosine. The mutation is transversion mutation.

Substitution of T for C at 18th position:

TAC GCA AGC AAT ACC GAT GAA

Substitution mutation is transition. Because a pyramidine is replaced by another pyramidine. There is no change in the amino acid coded in this mutation because of the degeneracy of the codon. Many codons code one amino acid.

Deletion of the C at position 18.

3' TAC GCA AGC AAT ACC GAG AA

This is deletion mutation. There is no change in he amino acid coded by the 6th codon. But 7th codon is of only 2 nucleotides, so no amino acid is coded by 7th codon. The polypeptide is shorter than normal.

Add a comment
Know the answer?
Add Answer to:
please explain Mailings Review View ferences av A. A AaBbCcDdEe 211 av AalbCcDdte AaBbCcD AaBbCcDdE AaB...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Answer The following Please, Name: Date: Transcription/Translation Practice Worksheet 1. Use the following DNA strand: TAC...

    Answer The following Please, Name: Date: Transcription/Translation Practice Worksheet 1. Use the following DNA strand: TAC GTC ACG AGA TGA GTT ATC ATT A. What is the mRNA synthesized from the DNA strand? B. What is the amino acid sequence that is then translated from this mRNA strand? 2. Use the following DNA stand: TAC TTG GCC ACG GAC TAA CAT GCA A. What is the complementary DNA strand of the above DNA strand? B. Using the complementary DNA strand,...

  • please help with #4 and #5 question 5 of 5 the cross lines indicate deletion of...

    please help with #4 and #5 question 5 of 5 the cross lines indicate deletion of the nucleotides. what type of mutation is this? what is the resulting polypeptide sequence? 3'- GTT - TAC - CTT - -CTC--TCC -TCA -GAC - ATC -GCA -5' (template strand) 5' - CAA - ATG - GAA - -GAG--AGG - AGT - CTG- TAG - CGT - 3' (non-template/coding strand) answer: It's a ___________________mutation. Final polypeptide sequence is N' - Met - GLU _______________    ...

  • 18 please 18a. The DNA is mutated on the 4th nucleotide (see bases in box) to...

    18 please 18a. The DNA is mutated on the 4th nucleotide (see bases in box) to the follo DNA :3TAC GCT GAG AGA GAC ACTS sº ATG CGA CTC TCT CTG TGA 3» 18b. (2pts) Does this mutation change the amino acid sequence? If yes - what is 18c. (2pts) Can this mutation change the way the protein functions? 18d. (2pts) How can a DNA mutation change protein function? Explain your answer in terms of gene expression. 15. Answer the...

  • A small portion of the human transport protein amino acid sequence is shown below. The upper...

    A small portion of the human transport protein amino acid sequence is shown below. The upper sequence is associated with darker skin, and the lower sequence is associated with lighter skin. What DNA base-pair change created the light-skin form of the human protein from the gene that coded for the dark-skir form? Ala-Gly Ala ThrPhe Ala Gly-Thr-Thr - Phe SECOND BASE SUAU TI Phe TUUU UUC UUA UUG] TUCU UCC UCA UCG Ser (UAC LUGU) UGC UAA Stop UAG Stop...

  • A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA....

    A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA. Most mutations happen during DNA replication, but their effects are not seen until transcription and translation. Even a small mutation that changes a single nucleotide can have a major impact on the resulting proteins that are made in the cell. с The table following the amino acid chart lists a segment of a normal gene. Type in the corresponding mRNA strand and the amino...

  • A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’. Using the...

    A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’. Using the codon chart provided, answer the following questions: -What is the sequence of amino acids that is produced when this gene is translated? -If a mutation causes a substitution (an A instead of a T) 3’ CCA AGC ACT 5’, what effect will it have on the mRNA transcript AND on the protein? -What do we call this type of mutation? Second letter U С...

  • Question 10 (15 points) Given the following sequence for a template strand of DNA 3 -...

    Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...

  • The next DNA sequence is the MATRICE strand of a small gene. What is the complete...

    The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...

  • If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give...

    If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (c) Give the amino acid sequence. (1.5 marks) You will require the following genetic code to answer this question. Second letter с...

  • 15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC...

    15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT