Homework Answers
Solution: A Ribosomes in the process of translating mRNA:
A ribosome is the protein synthesis unit of the cell. Each ribosome is made up of two sub-units: larger ribosomal units and smaller ribosomal units.
the larger ribosomal units consist of 3 tRNA binding sites:
- P-site (Peptidyl site): it is the site for the binding of the initiator, i.e. initiation of the translation takes place at this site.
- A-site (Aminocyl site): it is the site where incoming tRNA with another amino acid group attaches.
- E-site (Exit site): it is the site for the exit of the deacylated tRNAs.
B Bonds tRNA form with other molecules:
- the anticodons present in the anticodon loop region of the t-RNA form 3 hydrogen bonds due to complementary base pairing with the codons present on the mRNA.
- the amino acid present on the amino acid binding region of the t-RNA at the A-site of the ribosome forms the peptide bond with another amino acid coming from the t-RNA present at the P-site of the ribosome.
Add Answer to:
8) Draw a ribosome in the process of translating an mRNA. A) Label each site. Include...
The image below is a mRNA message. Please draw a ribosome translating the message below. Draw...
The image below is a mRNA message.
Please draw a ribosome translating the message below. Draw the
ribosome with P-site ON CODON 3. In your image draw the ribosome
immediately prior to it translocating to the next codon.
It is important to draw tRNAs, amino
acids, etc in the correct location. Do not forget to label all of
the following: A-site (and tRNA), P-site (and tRNA), E-site (and
tRNA), large subunit, small subunit, all amino acids in their
correct positions...
Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work...
Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work to control the levels of Trpe peptide? What happens when tryptophan levels are high in the cell? When they are low? (drawings may be used to assist in your explanation)(B) Does this happen in eukaryotes, prokaryotes or both? Why? (6 pts) Leader peptide Met-Lys - Al-te-Phe Val- mRNA PPPAAGUUCACGUAAAAAGGGUAUCGACAAUGAAAGCAAUUUUCGUACUGA GUAGUA MARCGAAAUGCGUACCACUUAUGUGACGGGCAANGUCCUUCACGCGGUGGU stop)-Ser-Thr-Arg - Trp - Top- ACCCAGCCCGCCUAAUGAGCGGGCUUUUUUUUGAACAAAAUUAGAGAAUAAGAAUGCAAACA Met-Gin-The- Trpt polypeptide Site of transcription attenuation...
Class 13 Translation DTL 1. Draw a line representing mRNA that has already been processes (introns...
Class 13 Translation DTL 1. Draw a line representing mRNA that has already been processes (introns removed, cap and tail added). Label the 5' cap on left end and polyA tail. 2. An inch from the left add the start codon (AUG). 3. An inch from the right add one of the three stop codons. 4. Label the 5'UTR and 3 UTR (untranslated regions). 5. In the middle of your mRNA, draw two ovals representing the large and small subunits...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
15. Translation (RNA protein) has three main stages: initiation, elongation, and termination. a. Initiation occurs when...
15. Translation (RNA protein) has three main stages: initiation, elongation, and termination. a. Initiation occurs when the small ___________________ subunit binds to the ____ end of mRNA and is then joined by the large _________________ subunit (which has three sites called the A, P, and E sites). Once the complex is formed, the _______________ begins to read the mRNA in a ____ to ____ direction. When it reaches the first start codon (_________) a tRNA carrying the amino acid ______________________...
si 0 0 7 homework - Word Sign in - 0 X File Home Insert Design...
si 0 0 7 homework - Word Sign in - 0 X File Home Insert Design Layout References Mailings Review View Help Tell me what you want to do Share % Cut A Еe Copy Times New R V 11 VA A Aa BI U abe X, X A ay - A E 7 ESE ALI B АавьСcІ АавьСcІ Аавьс Аавьссс Аав Аавьссс Аавьсср 1 Normal 11 No Spac... Heading 1 Heading 2 Title Subtitle Subtle Em... E Paste *Format...
1. (6 pts.) The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the sequence of the tRNAs read? What...
1. (6 pts.) The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the sequence of the tRNAs read? What is the sequence of the amino acids? 2. (4 pts.) Describe the difference between cotranslational and post translational protein localization. Be specific-a well-labeled diagram could help. 3. (6 pts.) Make a diagram of the prokaryotic initiation of transcription - include the +1 start site, the-10 and the -35 sites and RNA polymerase plus sigma factor. 4. (4 pts.) Describe in detail the movement of...
30) The organelle that performs the process of translation has room for thre mRNA/ rRNA/ tRNA) molecules. Except for the molecule carrying the very first amino acid, all enter this organelle at t...
30) The organelle that performs the process of translation has room for thre mRNA/ rRNA/ tRNA) molecules. Except for the molecule carrying the very first amino acid, all enter this organelle at the site. The movement of the ribosome with respect to the mRNA is (translation/ translocation), and it occurs each time a known as new amino acid is added to the polypeptide chain, in other words, during the cycle of the ribosome. This movement is powered by the ATP/...
C++: Translating mRNA sequence help Homework Description Codon 1 You are working in a bioinformatics lab...
C++: Translating mRNA sequence help
Homework Description Codon 1 You are working in a bioinformatics lab studying messenger RNA (mRNA) sequences. mRNA is a sequence of the nucleotide bases (Adenine, Cytosine, Guanine, and Uracil) that conveys information stored in DNA to Ribosomes for translation into proteins. The bases in the sequences are denoted by the first letters of the nucleotide bases (e.g. A, C, G, and U). A sequence of mRNA is made up of hundres to thousands of nucleotide...
Population group discussion Draw and consider the three types of survivorship curves (be sure to label...
Population group discussion Draw and consider the three types of survivorship curves (be sure to label the axes). Discuss and pick and organism for each type of curve, explaining what about the natural history of the species makes it fit that pattern. With an organism of your group's choice, consider a species with changing abundance patterns in multiple sites that you monitor: one year low, the next medium, the next high, the next year none, then low, medium, high, again....
The image below is a mRNA message.
Please draw a ribosome translating the message below. Draw the
ribosome with P-site ON CODON 3. In your image draw the ribosome
immediately prior to it translocating to the next codon.
It is important to draw tRNAs, amino
acids, etc in the correct location. Do not forget to label all of
the following: A-site (and tRNA), P-site (and tRNA), E-site (and
tRNA), large subunit, small subunit, all amino acids in their
correct positions...
Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work to control the levels of Trpe peptide? What happens when tryptophan levels are high in the cell? When they are low? (drawings may be used to assist in your explanation)(B) Does this happen in eukaryotes, prokaryotes or both? Why? (6 pts) Leader peptide Met-Lys - Al-te-Phe Val- mRNA PPPAAGUUCACGUAAAAAGGGUAUCGACAAUGAAAGCAAUUUUCGUACUGA GUAGUA MARCGAAAUGCGUACCACUUAUGUGACGGGCAANGUCCUUCACGCGGUGGU stop)-Ser-Thr-Arg - Trp - Top- ACCCAGCCCGCCUAAUGAGCGGGCUUUUUUUUGAACAAAAUUAGAGAAUAAGAAUGCAAACA Met-Gin-The- Trpt polypeptide Site of transcription attenuation...
Class 13 Translation DTL 1. Draw a line representing mRNA that has already been processes (introns removed, cap and tail added). Label the 5' cap on left end and polyA tail. 2. An inch from the left add the start codon (AUG). 3. An inch from the right add one of the three stop codons. 4. Label the 5'UTR and 3 UTR (untranslated regions). 5. In the middle of your mRNA, draw two ovals representing the large and small subunits...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
si 0 0 7 homework - Word Sign in - 0 X File Home Insert Design Layout References Mailings Review View Help Tell me what you want to do Share % Cut A Еe Copy Times New R V 11 VA A Aa BI U abe X, X A ay - A E 7 ESE ALI B АавьСcІ АавьСcІ Аавьс Аавьссс Аав Аавьссс Аавьсср 1 Normal 11 No Spac... Heading 1 Heading 2 Title Subtitle Subtle Em... E Paste *Format...
1. (6 pts.) The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the sequence of the tRNAs read? What is the sequence of the amino acids? 2. (4 pts.) Describe the difference between cotranslational and post translational protein localization. Be specific-a well-labeled diagram could help. 3. (6 pts.) Make a diagram of the prokaryotic initiation of transcription - include the +1 start site, the-10 and the -35 sites and RNA polymerase plus sigma factor. 4. (4 pts.) Describe in detail the movement of...
30) The organelle that performs the process of translation has room for thre mRNA/ rRNA/ tRNA) molecules. Except for the molecule carrying the very first amino acid, all enter this organelle at the site. The movement of the ribosome with respect to the mRNA is (translation/ translocation), and it occurs each time a known as new amino acid is added to the polypeptide chain, in other words, during the cycle of the ribosome. This movement is powered by the ATP/...
C++: Translating mRNA sequence help
Homework Description Codon 1 You are working in a bioinformatics lab studying messenger RNA (mRNA) sequences. mRNA is a sequence of the nucleotide bases (Adenine, Cytosine, Guanine, and Uracil) that conveys information stored in DNA to Ribosomes for translation into proteins. The bases in the sequences are denoted by the first letters of the nucleotide bases (e.g. A, C, G, and U). A sequence of mRNA is made up of hundres to thousands of nucleotide...
Population group discussion Draw and consider the three types of survivorship curves (be sure to label the axes). Discuss and pick and organism for each type of curve, explaining what about the natural history of the species makes it fit that pattern. With an organism of your group's choice, consider a species with changing abundance patterns in multiple sites that you monitor: one year low, the next medium, the next high, the next year none, then low, medium, high, again....
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 11 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 11 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 11 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 11 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 11 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 11 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 11 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 11 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 11 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 11 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 11 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 11 months ago