Question
help with these
• Questions 14-15: Use the figure on the right to answer to the next questions: What is Process 1 and Process 2? Select the c
0 0
Add a comment Improve this question Transcribed image text
Answer #1

14: Process 1- C splicing.

In RNA splicing, specific parts of the pre-mRNA, called introns are recognized and removed by a protein-and-RNA complex called the spliceosome.

15. Process 2- D translation

The process of protein synthesis from amino acid sequences specified by the sequence of codons in messenger RNA is called translation.

16. Answer: correct option D.Thr E AGG GT CC À Ć 31 31 TCCC AG GFG 51 - (Serves as template Strand Torans cription RNA eggono s AGGGUCCA C 3

Add a comment
Know the answer?
Add Answer to:
help with these • Questions 14-15: Use the figure on the right to answer to the...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Replication, Transcription, and Translation >> Use the provided DNA sequence to generate an amino acid sequence...

    Replication, Transcription, and Translation >> Use the provided DNA sequence to generate an amino acid sequence > Replication: use base pairing rules (A-T, C-G) to create a new strand of DNA Transcription: use the new strand of DNA to make a strand of RNA; don't forget that RNA uses U instead of T > Translation: use the genetic code to determine the amino acid sequence w BEUTE ZERBS 21 Second letter WAU) Tyr Urddon Stop UGI UAG Stop UGG Osclone...

  • Which term describes the process by which a single strand of DNA serves as a template...

    Which term describes the process by which a single strand of DNA serves as a template for the synthesis of an RNA molecule? translation transcription initiation elongation replication

  • 14.2 Modeling the Structure and Function of Nucleic Acids and Their Products 2. The following diagram...

    14.2 Modeling the Structure and Function of Nucleic Acids and Their Products 2. The following diagram represents some of the puzzle piece pieces used in this section. a Assembled in this form, do they represent an amino acid, c. a portion of messenger RNA, or a deoxyribonucleotide (b) Explain your answer. Opo 3. Why is DNA often called a double helix? 4. State the following ratios. (a) Guanine to cytosine in a double-stranded DNA molecule: (b) Adenine to thymine: -...

  • A model that represents a process occurring in a cell of a particular organism is shown...

    A model that represents a process occurring in a cell of a particular organism is shown in Figure 1. ATGATCTCGTAA AUGAUCU TTTTTTT TÁCTAGÁGCATT Figure 1. Process occurring in a cell Which of the following correctly explains the process shown in Figure 1 ? A) DNA replication is occurring because replication is semi-conservative and the new strand is a copy of the template strand. Initiation of transcription is occurring because a strand of RNA is being produced from a DNA template...

  • 1. DNA is coiled around what type of proteins to form nucleosomes A. Polymerases DNA replication...

    1. DNA is coiled around what type of proteins to form nucleosomes A. Polymerases DNA replication of the lagging strand is discontinuous B. Transcription factors DNA replication of the lagging strand is continuous C. Helicases D. Histones E. DICER 2. Which of the following statements is true? A. DNA replication of the leading strand is discontinuous B. DNA replication of the lagging strand is discontinuous C. DNA replication of the leading strand is dispersive D. DNA replication of the lagging...

  • If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What...

    If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What amino acid would this result in after transcription and translation? Pro (Proline) Ser (Serine) Val (Valine) Arg (Arginine) Question 20 1 pts What is created during transcription? a strand of codons O a strand of tRNA a strand of anticodons a polypeptide • a strand of DNA IPS Which letter (representing a phase of the cell cycle) would you observe (S phase) synthesis and...

  • опре... А SENIOR COMPR... ♡ ♡ ♡ ♡ 14 / 16 63.8% SUCCES WITH PILLS e....

    опре... А SENIOR COMPR... ♡ ♡ ♡ ♡ 14 / 16 63.8% SUCCES WITH PILLS e. Proteins are being digested to provide energy. 106. CELL BIOLOGY BIOL 3480 Which one of the following is incorrect about genetic code? a. It is fairly universal b. It is a triplet code. c. It is non-overlapping. d. It is degenerate. e. There is a single three-letter code per each amino acid. CELL BIOLOGY BIOL 3480 Which one of the following is incorrect about...

  • 15. The term that describes the directionality of the two strands in DNA Is A antidirectional...

    15. The term that describes the directionality of the two strands in DNA Is A antidirectional B polydirectional Csemiparallel D. antiparallel E ntisequencial 16. Which of the following enzymes synthesis new DNA during DNA replication? ADNA primase B. RNA polymerase CONA polymerase D Helicase E DNA ligase 17. Which of the following enzymes generates a covalent bond between Okazaki fragments? A DNA primase B. RNA polymerase C DNA polymerase D Helicase E. DNA ligase strand. 18. During DNA replication Okazaki...

  • The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA...

    The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA sequence: TACCAAGGAGCATTAGATACT a.) What is the complementary DNA sequence that would be made if the sequence shown above were used as the template strand during DNA replication? (1 pt) b.) What is the mRNA that would be made from the DNA sequence shown (the sequence given NOT your answer to part a) if it were used as the template strand during transcription? (1 pt)...

  • 28 29 30 31 32 33 28. Genes found in segments of chromosome called heterochromatin would...

    28 29 30 31 32 33 28. Genes found in segments of chromosome called heterochromatin would likely be expressed at high levels. expressed at low levels, or not at all. deleted before replication. maternally inherited only. none of these 29. (Use this representation to answer the following question.) DNA template strand 5 3' DNA complementary strand 3' 5' Using the double-stranded molecule above, in which direction does the RNA polymerase enzyme move? 3' → 5' along the template strand 5'...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT