Question

please answer ( c ) and ( b )

Read each question carefully, Write your response in the space provided for an question. Answers must be written out in paragraph form. Outlines, buleted alone are not acceptable and will not be scored. Researchers studying the phylogenetic relationships among African elephants (Loxodonta arricana), Asian elephants (Elephas maximus), and woolly mammoths (Mammuthus primigenius) analyzed cytochrome b DNA sequences from several organisms of each species. Cytochrome b is a mitochondrial protein that functions in the electron transport chain. Partial sequences of cytochrome b mitochondrial DNA are often used in phylogenetic analyses. DNA was obtained from mammoth bone fragments radiocarbon dated to between 12,000 and 14,000 years ago and from living African and Asian elephants. Table 1 shows a partial cytochrome b DNA sequence for the reference individual (an African elephant) and some of the sample individuals studied. Dugongs (Dugong dugon) were identified as the outgroup in this study. Dugongs are marine mammals that are relatives of the larger group of elephant-like animals, the proboscideans. Table 1. DNA sequence data for three species showing only the sequence differences Reference Loxodonta AAAAAATCCTTCTTTACACTCCA Loxodonta-1 .G.CG......T...G......G Loxodonta-2 •G.CG......T...G.....T. Elephas-1 .GGC......CT.CCCGTCT.. Elephas-2 .GGC......CTCCCC.GTCT. Mammuthus-1 CG. C.G.T...T.C.CT.T... Mammuthus-2 CG.C.G.T...T.C.C .T.... (a) Based on the data in Table 1, identify the animal that has the greatest number of sequence differences from the reference animal.

Answer 1

Answer:

(a) A phylogenetic tree is a diagrammatic representation of showing how organisms are related to one another. Mitochondrial DNA sequences are more conserved the nuclear DNA sequences and hence used in phylogenetic.

Based on the data in Table 1, the animal that has the greatest number of sequence differences from the reference animal is Elephas-2.

(b) Based on the data in Table 1, the evolutionary relationship fo the species can be shown in the following way.

Elephas maximus Loxodonta africana Mammuthus primigenius Dugong dugon

(c) Molecular data from fossils cane be used in dating to know the actual age of the fossil. This information are compared with the molecular data of living organisms. The comparison is made in the DNA sequences and then fossil age. The integration of DNA unique sequences and age of the ancestral species helps to determine the evolutionary history of organisms and their inert-relationships.

(d) Many a times changes in a single base pair of a specific homologous gene has a drastic change in the morphology of an organism. Therefore, organisms that are widely different in morphology can have a close evolutionary relationship.