Question

After a BLAST search you find a protein that gave you a bit score of 34....

After a BLAST search you find a protein that gave you a bit score of 34.
Which arguments would you use to convince your peers that this protein is
important to isolate and characterize further?

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Protein characterization plays a major role in which it can be involved in experimental methods that can influence various factors on extracted protein concentration and extraction as the ratio of solvent to dry material can be seen, So in order to get the suitable conditions for extraction of the detection and isolation of a protein purification can be characterization of its structure and function. The sensitive methods and techniques that follow can be the resulted in recent advancements that has made in molecular medicine. The protein sequence can be seen by using electro-spray ionization in which any size of protein can be sequenced and also some difficulties can be  araised when  the protein size increases. In mass spectrometry Liquid samples can be easily prepared because of greater solubility of peptides. The proteins can be complex by characterization, when the final protein that is purified from natural sources that can be expressed different cell cultures and drug development process which is essential.

Here the BLAST can be derive  the multiple sequence alignment that can be  detected by threshold using protein-protein BLAST and are used for  further  database which is the  update for subsequent iterations with newly detected sequences and also provides the detecting distant relationships between the proteins that are formed. As the complex structure proteins has the  intrinsic nature of each protein that can makes the character of protein  more and more  complicated than the characterization of the smaller molecules that are commonly observed in highly purified proteins.

Add a comment
Know the answer?
Add Answer to:
After a BLAST search you find a protein that gave you a bit score of 34....
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Use BLAST to find DNA sequences in databases Perform a BLAST search as follows: Do an...

    Use BLAST to find DNA sequences in databases Perform a BLAST search as follows: Do an Internet search for “ncbi blast”. Click on the link for the result: BLAST: Basic Local Alignment Search Tool. Under the heading “Basic BLAST,” click on “nucleotide blast”. pMCT118_F   5’- GAAACTGGCCTCCAAACACTGCCCGCCG -3’ (forward primer) pMCT118_R   5’- GTCTTGTTGGAGATGCACGTGCCCCTTGC -3’ (reverse primer) Enter the pMCT118 primer (query) into the search window. (see Moodle metacourse page for the file – just copy and paste the sequence into the...

  • In your BLAST search for homologs of the Salmonella RtcR regulatory protein, you found multiple homologs...

    In your BLAST search for homologs of the Salmonella RtcR regulatory protein, you found multiple homologs in a Klebsiella species that were likely to be bEBPs controlling various operons in the sigma54 regulon of Klebsiella. These homologues in Klebsiella are likely paralogs. What is the likely mechanism for evolution of these transcriptional regulators? A) Horizontal gene transfer of multiple genes by transduction B) Horizontal gene transfer of multiple genes by transformation C) Duplication and divergent evolution through mutation D) Horizontal...

  • BINF4000 chapter 7, question 6 You have a protein sequence and you want to know iis...

    BINF4000 chapter 7, question 6 You have a protein sequence and you want to know iis structure in a short time. you perform BLAST and PSI-BLAST searches of the PDB and you find a sequence with 15% amino acid identity to your protein. The e-value is .5. Which of the following options would you choose to achieve your goal. A. Use X-ray crystallography B. Use NMR spectroscopy C. Submit your sequence to a protein structure prediction server that performs homology...

  • After performing ChIP-seq, you find that the protein you are working on binds to the promoter...

    After performing ChIP-seq, you find that the protein you are working on binds to the promoter and just into the gene body of many genes throughout the genome. You hypothesize this protein may be important for RNA Pol II pausing and you want to gain nucleotide resolution of the transcripts this protein directly regulates. After depleting this protein, what technique would you perform to determine, at nucleotide resolution, the transcription and potential change to RNA Pol II pausing resulting loss...

  • We will refer to the protein as sequence2. It was just 40 amino acids long and...

    We will refer to the protein as sequence2. It was just 40 amino acids long and had the following amino acid sequence >sequence2 MSAEALADPAADPLAGNNPDADPEAINLKAIAALAKALLG Using your knowledge of BLAST searching particularly “Protein BLAST” (http://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastp&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome), the Expasy (http://www.expasy.org/) and the BLASTP align2seq (http://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch&BLAST_SPEC=blast2seq&LINK_LOC=align2seq ) Answer the following questions: a) What is the identity score between the query protein sequence (i.e. sequence2) and the highest scoring (best) aligning sequence from the BLAST search? (1 mark) b) Using similarity to other species as...

  • 34. (6 points) Currently you are studying threonine synthesis in yeast. To find genes whose protein...

    34. (6 points) Currently you are studying threonine synthesis in yeast. To find genes whose protein products are important for threonine synthesis, you perform a mutagenesis to find mutants that require a source of threonine to grow. You find a total of nine mutants, all of which have recessive phenotypes. You perform complementation tests with all of your mutants. Below are the results for your complementation tests. A (+) means growth and a() means no growth: mtl mt2mt3m4 mt mt...

  • The definition we gave for a function is a bit ambiguous. For example, what exactly is a "rule"? ...

    The definition we gave for a function is a bit ambiguous. For example, what exactly is a "rule"? We can give a rigorous mathematical definition of a function. Most mathematicians don't use this on an everyday basis, but it is important to know that it exists and see it once in your life. Notice this is very closely related to the idea of the graph of a function. Definition 9. Let X and Y be sets. Let R-X × Y...

  • You are assigned to purify a protein from an E.coli cell lysate. The following information is...

    You are assigned to purify a protein from an E.coli cell lysate. The following information is provided to you about the target protein. The protein has an N-terminal 6X histidine tag (His-tag) attached to it The protein is very stable in PBS (Phosphate Buffered Saline) buffer that you need to use as the storage buffer after purification It is an enzyme that will be used as a potential drug. You have the amino acid sequence of the protein. Based on...

  • Background Context: After completing this course, you find yourself at a party. It just so happens...

    Background Context: After completing this course, you find yourself at a party. It just so happens that an important decision-maker in the job that you are applying for is also there. He is an Economics major, of course! He knows that you are going back to school, and that you have just studied ECN 2013. He asks you to explain the most meaningful concept(s) that you have learned, He is aware of what is going on the economy and has...

  • 4.     (Challenge) You are purifying a protein from the brain of patients with an unusual type of...

    4.     (Challenge) You are purifying a protein from the brain of patients with an unusual type of dementia triggered by a coronavirus and you hypothesize that this protein may be a signature molecule of this type of dementia. To pursue this hypothesis, you collect brain tissue from patients post mortem, do differential centrifugation, density gradient centrifugation, CM (carboxymethyl cellulose) ion exchange chromatography and gel filtration. You then assess the purity of your protein using both native and SDS gel electrophoresis. The...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT