Question

A: The gene that codes for the rho protein in a specific species of bacteria is...

A: The gene that codes for the rho protein in a specific species of bacteria is deleted. What function is likely lost because of this deletion? Be specific.

B: What role does the TBP (TATA-Binding Protein) play in transcriptional initiation?

C: What is the purpose of having a 5’ CAP on eukaryotic mRNA?

D: Where do processed mRNA’s go after leaving the nucleus and how?

Please answer and explain

E: Explain the role of snRNPs in RNA processing. Be specific.

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Date: Page no: Anuwen Rho gene Rho protein hexmen of single polypeptide (14909) Rho protein haave Capability to bind with RNADate: Page no: o purpose of having a s cap on miRNA 5 Cap is a part of RNA processing many enzyme are helpful en processingthane rabubaka Send hand Date:_ Page no: E role of SnRaps in processing - Removing of intron - SnRNA & protein (U, V2 y, us u

Add a comment
Know the answer?
Add Answer to:
A: The gene that codes for the rho protein in a specific species of bacteria is...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Describe how to control transcriptional initiation occurs in both PROKARYOTES and EUKARYOTES. Word bank: promoter   TATA-Binding...

    Describe how to control transcriptional initiation occurs in both PROKARYOTES and EUKARYOTES. Word bank: promoter   TATA-Binding Protein (TBP)   RNA polymerase + sigma factor enhancer    TATA-box       gene-specific transcription factors RNA polymerase + GTFs   phosphodiester bonds    -10 and -35 consensus sequences mediator protein   +1 Transcriptional Start Site (TSS)   deoxynucleoside triphosphates (dNTPs) template DNA RNA transcript.

  • 3. Prokaryotic and eukaryotic gene expression compared. Below is an incomplete table of prokaryotic and eukaryotic...

    3. Prokaryotic and eukaryotic gene expression compared. Below is an incomplete table of prokaryotic and eukaryotic gene expression in comparison. Fill in the blank using PPT slides, notes and the textbook. Prokaryotic gene expression Eukaryotic gene expression Overview Steps Transcription and translation Yes Transcription and translation coupled? Gene structure No introns Epigenetic modification (chromosome remodeling) transcription, translation, RNA processing, protein processing Transcription in the nucleus and translation in the cytoplasm Interrupted gene with exons and introns RNAPI, II, III Which...

  • QUESTION 1 QUESTION 5 QUESTION 11 Identify the components required for translation initiation in bacteria What...

    QUESTION 1 QUESTION 5 QUESTION 11 Identify the components required for translation initiation in bacteria What is the enzymatic component of the ribosome? A Protein Identify the TRANS components of the transcription initiation complex in bacteria ATFIE Bir RNA C. TATA BOX D-10 and 35 sequences E Signa factor B. Carbohydrates C.RNA CATFIE B. 5methyl guanosine cap C. Shine-Dalgamo Sequence D. Sigma factor CETFIID (TBP and TAFS) FTFIIB G. Initiator RNA H.10 and 35 sequences EL Smal ribosomal subunit J....

  • OK. So, this week we’re investigating the eukaryotic gene PPtrl, which codes for the Rbbl protein....

    OK. So, this week we’re investigating the eukaryotic gene PPtrl, which codes for the Rbbl protein. You painstakingly derived a segment of the transcribed sequence of this gene, which is listed below. What would be the mRNA sequence that corresponds with this segment? coding 5’ A T G C G T A A T G C T A 3’ template 3’ T A C G C A T T A C G A T 5’ mRNA 5’ A U G...

  • choose the right answer : 1- what is degradation of ' unwanted' proteins in eukaryotic cells...

    choose the right answer : 1- what is degradation of ' unwanted' proteins in eukaryotic cells A- polyribosomes B- proteasomes C- editosome D- spliceosomes 2- addition or deletion of bases causes which kind of mutation A- transition B- transcription C- transversion D- frameshift mutation 3- point mutation involve : A- change in single base pair B- deletion C- duplication D- insertion 4- what is the complementary m-RNA sequence for the DNA sequence C-A-A-G-G-T A- C-A-A-G-G-U B- G-U-U-C-C-A C- C-A-A-G-G-T D-...

  • Below is the DNA sequence of a protein-encoding Eukaryotic gene: 5’TAAACGCGATGGACCGACCATACAGTATCGACGCTCCAGGATGGTAAAATAAATGCCT3’ Based on this information, predict...

    Below is the DNA sequence of a protein-encoding Eukaryotic gene: 5’TAAACGCGATGGACCGACCATACAGTATCGACGCTCCAGGATGGTAAAATAAATGCCT3’ Based on this information, predict the mature mRNA sequence and the corresponding peptide sequence of this gene after transcription, RNA processing, and translation. Try to recognize and label the sequence features on the primary transcript you learned from the class that are important for Eukaryotic mRNA Processing (e.g. intron sites, poly-A adding site). Please also briefly describe the key steps taking place during RNA processing. For each step of...

  • Which of the following statements regarding the TATA binding protein (TBP) are true: Recognizes a sequence...

    Which of the following statements regarding the TATA binding protein (TBP) are true: Recognizes a sequence that is similar are identical to 5'TATAAA3' Ο Ο Ο All are correct. It is considered a universal transcription factor It is a part of TEIID protein complex It binds to a consensus sequence The backbone of a DNA molecule is made up of phosphate groups made up of sugars made up of alternating phosphate and sugar groups Made up of alternating sugars and...

  • Question 2: Transcription, RNA Processing and Translation A particular gene codes for a mature mRNA transcript...

    Question 2: Transcription, RNA Processing and Translation A particular gene codes for a mature mRNA transcript containing 1200 bases, which is translated into a protein containing 300 amino acids. A. How long is the coding sequence in this mRNA and how many nucleotides are in the UTRs? For the purposes of this question we are ignoring the G’ cap and the polyA tail. B. A mutant form of the gene created by one nucleotide being changed to another nucleotide also...

  • Once researchers identified DNA as the unit of inheritance, they asked how information was transferred from...

    Once researchers identified DNA as the unit of inheritance, they asked how information was transferred from the DNA in the nucleus to the site of protein synthesis in the cytoplasm. What is the mechanism of information transfer in eukarotes? Transfer RNA takes information from DNA directly to a ribosome, where protein synthesis takes place. DNA from a single gene is replicated and transferred to the cytoplasm, where it serves as a template for protein synthesis. Proteins transfer information from the...

  • Your friend decides to place Green Fluorescent Protein (GFP) under the control of the promoter from...

    Your friend decides to place Green Fluorescent Protein (GFP) under the control of the promoter from the lacZ gene we discussed in class. She put this expression plasmid into a bacterium. The promoter from the lacZ gene is diagrammed to the right.? 2) Your friend decides to place Green Fluorescent Protein (GFP) under the control of the promoter from the lacZ gene we discussed in class. She put this expression plasmid into a bacterium. The promoter from the lacZ gene...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT