OK. So, this week we’re investigating the eukaryotic gene PPtrl, which codes for the Rbbl protein. You painstakingly derived a segment of the transcribed sequence of this gene, which is listed below. What would be the mRNA sequence that corresponds with this segment?
|
coding |
5’ |
A |
T |
G |
C |
G |
T |
A |
A |
T |
G |
C |
T |
A |
3’ |
|
template |
3’ |
T |
A |
C |
G |
C |
A |
T |
T |
A |
C |
G |
A |
T |
5’ |
|
mRNA |
5’ |
A |
U |
G |
C |
G |
U |
A |
A |
U |
G |
C |
U |
A |
3’ |
Like prokaryotes eukaryoute's RNA polymerase doesn't bind directly to the promoter it requires accessory proteins called transcription factors
Eukaryoutes have a promoter sequence called TATA box
The TATA box binding proteins bind to it with other transcrption factors
The first TF bind to TATA box is TFII D
Then TAB ( TATA binding proteins binds to it and stabilize it)
Then TFII A and TFII B bind then TFII E,F,H bind and form transcription pre initiation complex.
The unwinding of DNA by pre initiation complex called transcription initiation complex
2) yes ,the processing of m RNA is very important to protect it from nuclease activity as well as to make mRNA intron free.
OK. So, this week we’re investigating the eukaryotic gene PPtrl, which codes for the Rbbl protein....
1. OK. So, let’s talk about CandyP, a delicious eukaryotic protein that tastes like a Snickers bar. a) You painstakingly derived the (mature) transcribed sequence for CandyP, which is listed below. What would be the mRNA sequence that corresponds with this segment? coding 5’ T A A T G C A G T A A G C 3’ template 3’ A T T A C G T C A T T C G 5’ 5’ U A A U G...
1. OK. So, let's talk about Candyp, a delicious eukaryotic protein that tastes like a Snickers bar. a) You painstakingly derived the (mature) transcribed sequence for Candy, which is listed below. What would be the mRNA sequence that corresponds with this segment? coding 5 TA A TG C AGT AAGC 3' template 3 ATT A C GT CAT I C G 5' b) OK, how you need to get E. coli to make a whole bunch of that protein. What...
This assignment is worth four points. Create the sequence of a eukaryotic gene (DNA) that would: Be transcribed Encode a primary transcript that would be fully processed into mRNA, including having one intron spliced out Be translated into a protein with the amino acid sequence: MPLEASE. I suggest starting by writing out all of the sequence elements necessary for every step of transcription and translation, so that you make sure you include each of those elements in your gene. Report...
4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is underlined. The +1 nucleotide is shown in boldface and red. a. Write the sequence of the mRNA that would be produced by this gene. You may assume that the gene ends at the end of the sequence shown, so you do not need to look for transcription termination signals. You may also assume that it has no introns 5' GCGGTATAACAGGACAGGCTGCATGAGAAGATTCCATCTTCCAGATCACTGTCCTTCTAGCCATGGAAAATGA CGAATTGTGACTGCCCCTGC3' mRNA (make sure...
Below is the DNA sequence of a protein-encoding Eukaryotic gene: 5’TAAACGCGATGGACCGACCATACAGTATCGACGCTCCAGGATGGTAAAATAAATGCCT3’ Based on this information, predict the mature mRNA sequence and the corresponding peptide sequence of this gene after transcription, RNA processing, and translation. Try to recognize and label the sequence features on the primary transcript you learned from the class that are important for Eukaryotic mRNA Processing (e.g. intron sites, poly-A adding site). Please also briefly describe the key steps taking place during RNA processing. For each step of...
The diagram below shows a structure of an eukaryotic gene. Each pattern refers to a different part of a gene. Using the pattern, label the diagram for the location of following: a. enhancer, b- promoter, c- transcription start, d- translation start: e- exon, i- intron, f- coading sequence, t1 -transcription stop, t2 -translation stop Put the corresponding letter on top of the pattern to show the location b. How pre-mRNA transcribed from this gene will look like? You may use...
3. Prokaryotic and eukaryotic gene expression compared. Below is an incomplete table of prokaryotic and eukaryotic gene expression in comparison. Fill in the blank using PPT slides, notes and the textbook. Prokaryotic gene expression Eukaryotic gene expression Overview Steps Transcription and translation Yes Transcription and translation coupled? Gene structure No introns Epigenetic modification (chromosome remodeling) transcription, translation, RNA processing, protein processing Transcription in the nucleus and translation in the cytoplasm Interrupted gene with exons and introns RNAPI, II, III Which...
answer parts e, f, and g
4. Look at the following diagram of a eukaryotic gene Polyadenylation anal region (100bpl ADNA 11,000 pl (1000bp) Con 1450b) chel 1750 a) At which section would transcription initiation occur? List the letter of the section. (0.5pts) b) Identify all sections that would be present in the pre-mRNA transcribed from this gene. List the letter of these sections. (0.5pts) c) Name the three processes that must occur to create a mature processed mRNA in...
The following is a eukaryotic DNA sequence. The coding sequence of the gene is in bold and italicized, and the promoter is enclosed in parenthesis. 5′ T G*A A G G A A T (TA T A A) T A C G A C C... A T G A T G T A C G C A T AAAC G T 3′ A mutation occurs in which a base (T) is inserted into the DNA sequence after the G, at...
Question 2: Transcription, RNA Processing and Translation A particular gene codes for a mature mRNA transcript containing 1200 bases, which is translated into a protein containing 300 amino acids. A. How long is the coding sequence in this mRNA and how many nucleotides are in the UTRs? For the purposes of this question we are ignoring the G’ cap and the polyA tail. B. A mutant form of the gene created by one nucleotide being changed to another nucleotide also...