Question

7. In bacteria the elongation stage of protein synthesis does not involve: A) aminoacyl-tRNAS B) EF-Tu C) GTP D) IF-2 E) pept

0 0
Add a comment Improve this question Transcribed image text
Answer #1

7. D. IF-2

IF-2 involves is initiation process and all other involves in elongation process

8. A. Amphipathic, An amphipathic molecule is a molecule that has both polar and non-polar parts.

Cholesterol is an amphipathic molecule (like phospholipids), meaning it has both hydrophilic and hydrophobic regions

  • Cholesterol’s hydroxyl (-OH) group is hydrophilic and aligns towards the phosphate heads of phospholipids
  • The remainder of the molecule (steroid ring and hydrocarbon tail) is hydrophobic and associates with the
  • phospholipid tails

9. A. Always recognises only one specific t-RNA

Because there is specific tRNA synthetase for a particular amino acid.

Each aminoacyl-tRNA synthetase has a binding site that recognizes a specific amino acid, and other binding areas that recognize a particular tRNA through unique identity sites at the acceptor stem and/or anticodon loop of the tRNA.

10. C Wherever Cys normally occurs

There is a specific aminoacyl tRNA synthetase for each of the 20 amino acids.

Once an amino acid is attached to a tRNA, the specificity for protein synthesis resides solely with the tRNA portion of the aminoacylated tRNA molecule.

The anticodon of the tRNA base pairs with the codon of the mRNA.

Here, cysteine can be put on tRNACys (Cys-tRNACys), chemically modified to the amino acid alanine (Ala-tRNACys), and then used in a biochemical system for protein synthesis. The resulting polypeptides now made in the biochemical reaction have alanine at positions normally occupied by cysteine.

Add a comment
Know the answer?
Add Answer to:
7. In bacteria the elongation stage of protein synthesis does not involve: A) aminoacyl-tRNAS B) EF-Tu...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work...

    Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work to control the levels of Trpe peptide? What happens when tryptophan levels are high in the cell? When they are low? (drawings may be used to assist in your explanation)(B) Does this happen in eukaryotes, prokaryotes or both? Why? (6 pts) Leader peptide Met-Lys - Al-te-Phe Val- mRNA PPPAAGUUCACGUAAAAAGGGUAUCGACAAUGAAAGCAAUUUUCGUACUGA GUAGUA MARCGAAAUGCGUACCACUUAUGUGACGGGCAANGUCCUUCACGCGGUGGU stop)-Ser-Thr-Arg - Trp - Top- ACCCAGCCCGCCUAAUGAGCGGGCUUUUUUUUGAACAAAAUUAGAGAAUAAGAAUGCAAACA Met-Gin-The- Trpt polypeptide Site of transcription attenuation...

  • During the ‘elongation’ stage of translation, after the arrival of each new tRNA: A. the amino...

    During the ‘elongation’ stage of translation, after the arrival of each new tRNA: A. the amino acid is ‘passed’ from the tRNA in the A site to the tRNA in the P site. B. newly arriving tRNAs must first bind to the E-site. C. the peptide is ‘passed’ from the tRNA in the P site to the tRNA in the A site. D. the new tRNA must first bind to the P-site of the ribosome Hi, i need help with...

  • 6:35 5 minutes ago 25) Which of the following turns off transcription by binding to the operator? A) repressons B) lactose C) RNA polymerase D) promoters E) enzymes 25) 26) In bacteria, what n...

    6:35 5 minutes ago 25) Which of the following turns off transcription by binding to the operator? A) repressons B) lactose C) RNA polymerase D) promoters E) enzymes 25) 26) In bacteria, what name is given to a cluster of genes with related functions, along with their control 26) A) exon B) operon C) promoter D) activator E) regulatory gene A mutant bacterial cell has a defective aminoacyl synthetase that attaches a lysine to tRNAs with the anticodon AAA instead...

  • s141) Which nucleotide is used for energy to drive protein synthesis? A) TTP B) CTP C)...

    s141) Which nucleotide is used for energy to drive protein synthesis? A) TTP B) CTP C) UTP D) GTP 2) Ribosomal RNA: A) Can bind to prokaryotic mRNA B) Plays no role in peptidyl transferase activity C) In eukaryotes, attaches to mRNA before transcription is completed D) All of the above 3) Spliceosomes: A) Are 40-60S, about the size of ribosomal subutnit B) Are necesssary for DNA replication C) Bind to RNA Polymerase D) Are composed entirely of proteins E)...

  • 1Plants can create new organs.................................................................. at seedling stage at vegetative stage at spring time at summer...

    1Plants can create new organs.................................................................. at seedling stage at vegetative stage at spring time at summer time all of the above 2.One of the compound below is NOT a primary product of photosynthesis.... A. Starch B. Sucrose C. Triose phosphate D. Glucose E. Phosphoglyceric acid (PGA) 3.Which chemical groups from a pair of amino acids must react to form a peptide bond? A. the two R-groups or sidechains B. the two carboxyls C. the two alpha carbons D. the amino...

  • Please answer ALL In DNA, which strand is continuously synthesized A) leading strand B) lagging strand...

    Please answer ALL In DNA, which strand is continuously synthesized A) leading strand B) lagging strand C) Okazaki fragments D) all of these Root nodules are used by plants for ______________ fixation. A) carbon B) nitrogen C) sulfur D) phosphorus DNA and RNA are composed of __________. A) fatty acid chains B) amino acids C) nucleotides D) none of these Which of these would be an example of a phenotype? A) the sequence of DNA nucleotides B) the sequence of...

  • all please Question 2 (1 point) ✓ Saved In Drosophila, the mutant black (b) has a...

    all please Question 2 (1 point) ✓ Saved In Drosophila, the mutant black (b) has a black body and the wild-type (b+) has a gray body; the mutant vestigial (v) has wings that are short and crumpled compared the long wild-type wings (v+). These genes are linked and are located on the X- chromosome. A cross between a female fly and a black, vestigial winged male fly produced the following progeny: gray (b+), normal (v+) 20 gray (b+), vestigial (v)...

  • 12. Antimicrobials may a. produce allergic reactions b. produce toxic effects not only to the microbe...

    12. Antimicrobials may a. produce allergic reactions b. produce toxic effects not only to the microbe but to the hoat c. kill bacteria in our bodies all the above 13. All of the following pertain to the role ofactivated helper T cells in cellular mediatesd immunity except a. differentiation into memory Th cells b. recognize MHC with antigenic peptide on macrophages c. activate Te cells indirectly lead to cytolysis through complement e. indirectl y lead to phagocytosis of large microorganisms...

  • The smallest chemical units of matter are atoms b) molecules c) protons d) neutrons e) electrons...

    The smallest chemical units of matter are atoms b) molecules c) protons d) neutrons e) electrons . Which of the following would have the largest size? a) an atom b) a molecule c) a proton d) a neutron e) an electron 3. Isotopes of an element differ in the number of a) protons in the nucleus b) electrons in the nucleus © neutrons in the nucleus d) electron clouds e) energy levels they contain 4. VO The atomic number represents...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT