Question

If you wanted to measure the levels of dpy-11 and bli-1 mRNA and protein in response...

If you wanted to measure the levels of dpy-11 and bli-1 mRNA and protein in response to the RNAi treatment, how would you do it?

0 0
Add a comment Improve this question Transcribed image text
Answer #1

First of all isolate all RNAs from cell using specific method like Isolation of Rna by Trizole or other method. Check whether in your RNAs you have mRNAs by running sample on agarose gel and confirm the presence of mRNAs. Then you can use Real time PCR to detect the presence of dpy-11 and bli-1 mRNA. First amplify dpy-11 and bli-1 mRNA using specific primers for this m-RNA and then analyse your amplification if dpy-11 and bli-1 mRNA were present does not interfere by RNAi than their will be amplification of this m-RNAs takes place. This can be detect by flurophore which produce more fluroscence on amplification. If RNAi is interefering your m-RNA then their will be no amplification of m-RNA.

For detection of protein Use Western blotting technique (Outlines):-

First harvest cells then sonicate cells in lamilee buffer after that run SDS page separate all proteins of harvested cell according to thier molecular weight. Transfer this protein in Gel onto specific membrane like PVDF or Nitrocellulose.

After that Use antibody against collagen protein or dpy-11/bli-1 mRNA encoded protein than incubate overnight than after few washing of blot develop your blot using X-RAY film or chemiDocs.

In absence of RNAi you will get your protein band on your blot.

Add a comment
Know the answer?
Add Answer to:
If you wanted to measure the levels of dpy-11 and bli-1 mRNA and protein in response...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Using Western Blot analysis, you have determined that protein levels of the insulin receptor increase in...

    Using Western Blot analysis, you have determined that protein levels of the insulin receptor increase in cultured fibroblast cells after treatment with a new drug. Which of the following hypotheses could explain how this drug could increase protein levels (select all correct answers). A The drug could increase export of the mRNA from the nucleus, thus increasing mRNA levels and protein levels. B The drug could increase expression of the gene, therefore increasing mRNA levels and protein synthesis. C The...

  • If you wanted to find a protein that binds RNA to perhaps regulate RNA degradation or...

    If you wanted to find a protein that binds RNA to perhaps regulate RNA degradation or translation, you could test protein binding this RNA by __. (application question) A Gel shift B Southern C Northern D Western If one performed co-immunoprecipitation where antibodies were used to precipitate 1) TFIID (20 kD), 2) TFII B (40 kD) or 3) TFII H (50 kD) and then a western was performed with the TFII B antibody, which lanes (1,2, 3 or combination below)...

  • When you measure the absorption of light by a protein in solution, it is usually recommended...

    When you measure the absorption of light by a protein in solution, it is usually recommended to measure at absorption levels between 0.1 and 1 because, at higher than 1, the absorption is not linear with protein concentration, and below 0.1, the measurements are noisy and less reliable. The absorption coefficient of rhodopsin at 496 nm is 46000 M-cm-. If you have a 1 M solution of rhodopsin, how many times will you dilute the solution so that the diluted...

  • #59) During protein synthesis, what happens to the ribosome? A) attach to the mRNA molecule and...

    #59) During protein synthesis, what happens to the ribosome? A) attach to the mRNA molecule and travel along its length B) attach to the DNA molecule and travel along its length to produce an mRNA molecule C) Translate mRNA into tRNA D) Transcribe mRNA to tRNA E) Translate mRNA into DNA #60) if you digested the human genome (3 billion bp) with a 7-cutter restriction enzyme, approximately how many fragments would you get? A) 511461 B)183105 C)16384 D)88 E) None...

  • An mRNA is translated into a protein in a cell-free extract in the absence of presence...

    An mRNA is translated into a protein in a cell-free extract in the absence of presence of microsomes or endoplasmic reticulum. Samples are treated as follows: (I) no treatment, (II) addition of protease, (IIl) addition of protease and detergent, and (IV) disruption of mircosomes and addition of endoH, an enzyme removing N-linked sugars that are added in the ER. Analysis by gel electrophoresis is shown in the figure. 7. MICROSOMESİ MICROSOMES ABSENT PRESENT TREATMENT protease a. Proteih synthesis at the...

  • 1.Phase variation controls protein levels by a. altering the DNA sequence. b. changing the rate of...

    1.Phase variation controls protein levels by a. altering the DNA sequence. b. changing the rate of mRNA translation. c. changing the rate of mRNA stability. d. changing the rate of protein stability 2.Chlamydomonas spp. can survive at freezing temperatures in their natural Antarctic environment. They have 39 different RNA helicase genes, and it has been hypothesized some of these are activated at freezing temperatures. What technique would be used to test this? a. ChIP-seq b. CRISR-Cas9 c. RT-PCR d. DNA...

  • O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be...

    O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be provided with the DNA nucleotide sequence that codes for a hypothetical protein. The code will be provided to you in three fragments. You will have to tran- scribe the code into mRNA, remove an intron segment, and translate the mRNA into the protein. In addition, you will have to identify the beginning fragment the middle fragment, and the end fragment. Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGC CGCCAGGGCCCCGCCCCTCAGAAGTTGGT...

  • If you wanted to be able to see where a specific protein is located within a...

    If you wanted to be able to see where a specific protein is located within a cell and/or observe its movement over time, how might you accomplish this? “Looking through a microscope” is not a sufficient answer in and of itself. We can’t see the standard cellular form of proteins using most microscopy techniques and the ones that would allow us to directly view some of these larger native proteins require dead, specially prepared slices of cells.

  • 1. Ifyou wanted to make a 4 M NaCl solution and you wanted a full Liter...

    1. Ifyou wanted to make a 4 M NaCl solution and you wanted a full Liter of it, how would you make it? Describe all of the steps. (Remember from lab, molecular weight of NaCl is 58.44) 2. Now describe how you would dilute this 4 MNaCl solution by a 1:10 dilution -how would you do this? Again, make 1 Liter. 3. Suppose you wanted a 2: 50 dilution of a stock solution, but you wanted 200 mL of it....

  • 1. OK. So, let's talk about Candyp, a delicious eukaryotic protein that tastes like a Snickers...

    1. OK. So, let's talk about Candyp, a delicious eukaryotic protein that tastes like a Snickers bar. a) You painstakingly derived the (mature) transcribed sequence for Candy, which is listed below. What would be the mRNA sequence that corresponds with this segment? coding 5 TA A TG C AGT AAGC 3' template 3 ATT A C GT CAT I C G 5' b) OK, how you need to get E. coli to make a whole bunch of that protein. What...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT