Question
One Question Below:
3. The RNA polymerase from bacteriophage T7 recognizes specific promoter sequence and melts open the DNA to form a transcript
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Binding of polymerase depends upon the binding affinity which is the strength of the interaction between the biomolecule to its ligand. It is measured in terms of dissociation constant, Kd. The smallee the Kd, the greater is the affinity of the biomolecule for its target, and the more tightly it will bind.

T7 polymerase will bind to the promoter having big bulge and lesser Kd value, which is the DNA promoter having 8 base bulge. Because if the transcription bubble is big it will provide sufficient space for the promoter to bind tightly to the promoter region.

If the bulged base has smaller number the transcription bubble will not be able to provide sufficient binding site and the polymerase would require to use its helicase activity to make single stranded transcription bubble for transcription initiation.

So the answer will be the DNA promoter segment having 8 base bulge with 0.0013nM Kd.

Add a comment
Know the answer?
Add Answer to:
One Question Below: 3. The RNA polymerase from bacteriophage T7 recognizes specific promoter sequence and melts...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 4. The antibiotic cordycenin syntheon 3. The RNA polymerase from bacteriophage T7 recognizes specific promoter sequence...

    4. The antibiotic cordycenin syntheon 3. The RNA polymerase from bacteriophage T7 recognizes specific promoter sequence and melts open the DNA to form a transcription bubble. No other transcription factors are necessary for T7 RNA polymerase to initiate transcription. Dissociation constants (Ka) were measured for the interaction between the polymerase and DNA segments containing the promoter sequence. In some cases, the DNA contained a bulge, caused by a mismatch of one, four, or eight bases, to mimic the intermediates in...

  • please explain a and b shkaryote 4. Transcription. The DNA below contains a promoter sequence recognized...

    please explain a and b shkaryote 4. Transcription. The DNA below contains a promoter sequence recognized by E. coli RNA polymerase (NAF) TOUCA s. 5'-AACGTAACTGAATTCCGCAATGGCATGGCATTGCTCATTATACTTAGTCTAATATGTCAA-3' 3'-TTGCATTGACTTAAGGCGTTACCGTACCGTAACGAGTAATATGAATCAGATTATACAGTI-5 A THAT A) Draw boxes around the two promoter elements, centered at - 10 and -35, relative to the start site of transcription. B) Transcription starts at the A-T base pair, which is indicated by the bold letters in the DNA shown above. Based on the asymmetric promoter sequence, RNAP selects one strand as...

  • can someone help explain part b 4. Transcription. The DNA below contains a promoter sequence recognized...

    can someone help explain part b 4. Transcription. The DNA below contains a promoter sequence recognized by E. coli RNA polymerase (KNAP): 5'-AACGTAACTGAATTCCGCAATGGCATGGCATTGCTCATTATACTTAGTCTAATATGTCAA-3 3'-TTGCATTGACTTAAGGCGTTACCGTACCGTAACGAGTAATATGAATCAGATTATACAGTT-5'. A) B) Draw boxes around the two promoter elements, centered at -10 and -35. relative to the start site of transcription Transcription starts at the A-T base pair, which is indicated by the bold letters in the DNA shown above. Based on the asymmetric promoter sequence, RNAP selects one strand as the template for RNA synthesis....

  • 1. A sequence of a eukaryotic gene (coding strand) is shown below, RNA polymerase recognizes the...

    1. A sequence of a eukaryotic gene (coding strand) is shown below, RNA polymerase recognizes the sequence ‘TATAAT’ and initiates transcription six nucleotides downstream of the sequence. The in tron splice sites are CUU (5’ splice site) and AAG (3’ splice site), poly -A tails are added following the sequence AGUUGG. The poly- A tails are 20 nucleotides. a. Predict the sequence of mature mRNA and denote 5’ and 3’ ends. b. If this is an oncogene that is elevated...

  • Answer the questions: Question 11 Recognition/binding site of RNA polymerase is called a Receptorb. Promoter ....

    Answer the questions: Question 11 Recognition/binding site of RNA polymerase is called a Receptorb. Promoter . Facilitatord. Terminator Question 12 .A specific factor helps RNA polymerase binding to promoters and transcribe genes a Delta b. Beta Gamma d. Sigma Question 13 ............ Promoters lack a TATA box are referred to as TATA less promoters, for example operon Housekeeping genes b. Functional genesc d. Structural genes Question 14 0.5 points Save Answer During "RNA processing" All of the exons are a....

  • allll pleas Question 14 (1 point) Eukaryotes modify a primary RNA transcript to generate a final...

    allll pleas Question 14 (1 point) Eukaryotes modify a primary RNA transcript to generate a final mRNA product. Which of the following modifications is something that occurs to eukaryotic RNA (which one is correct): OA) removing exons from the transcript B) adding introns into the transcript C) adding a poly(A) tail to the transcript by poly(A) polymerase OD) adding start codons to the transcript after its synthesis E) removing a 5' cap from the transcript Question 18 (1 point) Origins,...

  • answer all the questions 1) All of the following contribute to promoter binding by RNA polymerase...

    answer all the questions 1) All of the following contribute to promoter binding by RNA polymerase I in bacteria except: a)-10 consensus sequence b)-35 consensus sequence c) rho factor d) sigma factor e) none of the above 2) Common structural changes or lesions found in DNA after exposure to ultraviolet light are: a) thymine dimers b) cytosine dimers c) purine dimers d) adenine dimers e) none of the above 3) What is the function of the sigma subunit in the...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT