Question

amplify a 161 bp fragment of the vaca gene which is only found in H. pylori. You culture bacteria from gastric biopsies, extr

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Option(a) the PCR ks contaminated as there is band in negative control though negative control do not have any template but it is showing amplification same as other sample

Add a comment
Know the answer?
Add Answer to:
amplify a 161 bp fragment of the vaca gene which is only found in H. pylori....
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • You are using PCR to amplify a 300 bp target sequence, a portion of Gene X,...

    You are using PCR to amplify a 300 bp target sequence, a portion of Gene X, from human genomic DNA isolated from patients' blood samples. The instructions for this procedure tell you to include Samples A and B, whose contents are listed below, with each batch of patient samples that you run. Ingredients Sample A Sample B 10x PCR Buffer (Tris,KCI,MgCl2,BSA) 5 mL 5 mL H2O 37.8mL 38.8mL dNTP's 3 mL 3 mL Taq DNA polymerase 0.2 mL 0.2 mL...

  • Based on the gel image and the following information, answer the questions and fill in the...

    Based on the gel image and the following information, answer the questions and fill in the table below. Order of wells: snack 1, 100bp ladder, snack 2, positive control, negative control Questions: 1. Did the controls work and what do they tell you? 2. Do snack 1 and snack 2 contain the 35S promoter? 3. What conclusion can you draw about the corn-based snacks tested? Results: sample PCR product amplified by 35S primers (~160bp) (yes or no) PCR product amplified...

  • polymerase chain reaction to amplify a 500 bp region of human dna corresponding to a gene...

    polymerase chain reaction to amplify a 500 bp region of human dna corresponding to a gene of interest. when your pcr reaction is complete, you plan to run the product on an agarose gel to determine if your pcr reaction worked correctly. 1. Explain how you going to make the pcr soup and why you going to make it this way. 2. State the what's in the control and why the controls are so important

  • After PCR is performed the products are run out on an agarose gel. In the figure...

    After PCR is performed the products are run out on an agarose gel. In the figure below, grey bands represent the wells the PCR product was loaded into. The white bands represent DNA fragments produced by PCR. The target fragment amplified by the primers was 1,500 bp in size. The ladder is a standard DNA ladder containing bands of various sizes between 5,000 and 1,000 bp. The negative control contained only molecular grade water*. The positive control contained DNA known...

  • 2. PCR amplification of the TAS2R38 gene a. The number of copies of the 303 bp sequence grows exp...

    2. PCR amplification of the TAS2R38 gene a. The number of copies of the 303 bp sequence grows exponentially (1-2-4-8-etc) after each cycle. The number of cycles we used is on page 97. What is the number of copies of the 303 bp fragment that will theoretically be present at the end of our reaction? b. Denaturation of the 303 bp segment of the TAS2R38 gene is a critical first step in the PCR perties of a DNA segment that...

  • Below is a set of experiments for cloning the human growth hormone (HGH) gene and then...

    Below is a set of experiments for cloning the human growth hormone (HGH) gene and then expressing the HGH protein in E. coli starting from human pituitary glands and a tube of plasmid vector DNA. The plasmid expression vector contains the arabinose inducible expression system. Specify the correct order for carrying out these experiments, using the letter codes in front of each procedure. Use all of the steps in your answer, except for one step that should NOT be included....

  • The molecular weight marker is an example of a  ["Positive" OR "Negative"] control. Which would it be?...

    The molecular weight marker is an example of a  ["Positive" OR "Negative"] control. Which would it be? In relation to this what would be the the main goal of loading dye in gel electrophoresis? A. To make the reaction run faster. B. It is a positive control. C. To measure the base pair size of the DNA fragments. D. To weigh down the samples. Its either A or C correct but which one between the two im confused?

  • 1. The following DNA sequence was discovered in a metagenomic analysis of a soil sample. It...

    1. The following DNA sequence was discovered in a metagenomic analysis of a soil sample. It is 249 bp long, and is suspected to be a serine protease inhibitor ATGAGCAGCGGCGGCCTGCTGCTGCTGCTGGGCCTGCTGACCTTTTGCGCGGAACTGACC CCGGTGAGCAGCCGCAAACGCCATCCGTATTGCAACCTGCCGCCGGATCCGGGCCCGTGC CATGATAACAAATTTGCGTTTTATCATCATCCGGCGAGCAACAAATGCAAAGAATTTGTG TATGGCGGCTGCGGCGGCAACGATAACCGCTTTAAAACCCGCAACAAATGCCAGTGCACC TGCAGCGGC a) Which sequencing method would you use to sequence a gene in this size range, and why? (Name of technique and 1-2 sentence explanation.) b) What technique would you use to amplify the DNA, in order to make more of it for future experiments? (What is...

  • En (2 points) You isolated your mitochondrial DNA in Part I. In step 6, you discard...

    En (2 points) You isolated your mitochondrial DNA in Part I. In step 6, you discard the supernatant, but keep the pellet. In step 15, you discard the pellet, but keep the supernatant. Explain why the pattern is different between the two steps and the consequence of mixing up these two steps. Procedure Part 1: mt DNA Isolation from your cheek cells. Lysis solution is used to breakdown the cells in this step, you will isolate MEONA from cheek cells....

  • help with questions 5 to 10 please PCB 3023L Lab #4 Protocol & Worksheet (30pt) You...

    help with questions 5 to 10 please PCB 3023L Lab #4 Protocol & Worksheet (30pt) You may work in your lab groups durine class. but all written answers must be completed individually in your own words. 1) Using the plasmid map for orientation 1 and the cDNA map as a guide, complete the plasmid map for orientation #2. (4pt) 612 1318 1 - EcoRi EcoRI Xbal ECORV -Xbal- 1662 +Bell EcoRI EcoRV Not FP -- Xhol X 2015 PRSP +...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT