
For A I need help identifying which row of sequence each of the features are located on.
For B I need help understanding what would happen if the base highlighted in the second row of sequence changed from "g" to "a"
And for C I need help understanding what would occur if the base highlighted in the first row of sequence changes from "a" to "c"
A. 1. TATA box and transcription start site are located in the first row. Polyadenylation site is located at the last row.
2. Start codon in DNA is TAC (position 38 39 40) located at first row. Stop codon is located at 2nd row (TGA nt position 53 54 55)
3 5' UTR is located in first row and 3' UTR is located on 2nd row
B. Base position 92 is located at exon intron boundary. Exon intron boundary is very much important for excision of intron by spliceosomes. So, if any mutation occur at position 92, the intron will not be spliced.
C. Position 13 , the A is part of TATA box. So if there is C in place of A at the 13th position, RNA polymerase recognize TATA box and starts transcription. So any mutation at the TATA box will affect transcription.
For A I need help identifying which row of sequence each of the features are located...
Hello. I need some help with these genetics questions. Id grealty
appreciate the help!
Question 11 (1 point) An Of C) mutation results in O no transcription. inducible transcription. transcription but no translation. no translation constitutive transcription. Question 12 [1 point) What are the trans acting factors that control transcription in bacterial genes? cap. start codon, stop codon. O enhancers, Silencers, operator, promoter, polyadenylation signal 5 prime end of RNA, GU splice site, branch point. A. AG-splice site, polyadenylation signal...
I. Use the DNA sequence below, which encodes a prokaryotic gene to answer the following questions. 11 21 31 41 51 71 81 61 91 CGTAATTGAG GAGGTAGTTG ACGTATGAAT AGTTAACGTA CGGGGGGGAA 101 111 121 131 141 ACCCCCCCTT TTTTTTTTTC GAGCAATAAA AGGGTTACAG ATTGCATGCT a) Write down the corresponding sequences, find them in the sequence above and label them: -35 Consensus sequence: _(label as -35) -10 Consensus sequence (Pribnow box): _ __ (label as Pribnow) Shine-Dalgarno sequence in corresponding mRNA: __ (label as SD)...
Hello! I am working on this genetics problem and was wondering if
these two answers would make sense. Thank you for the help!
Question 1 (1 point) Saved Why can bacteria have poly-cistronic genes? Because they need multiple cistron organelles so they segregate evenly during cell division. Because they have many exons that are joined together before translation Because ribosomes can be loaded at multiple Shine Delgano/AUG sequences. Because ribosomes are loaded at the single CAP site. Because the stability...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
please help with all 3
Incorrect Question 19 0/10 pts The sequence below represents the first section of the coding strand of DNA of a structural gene in an prokaryotic organism. Position +1 is shown in orange. Please fill in the blanks that correspond. YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written. 5' GTAACTATAATTATGCGTATAATG 3' What would be the nucleotides that form the promoter? GUAACUAU...
Can someone outline how I would go from my DNA sequence to my
final product of coding the amino acids. I am confused on the
complimenting strands and which ones I would need.
Below is the coding sequence of very small prokaryotic gene. The coding sequence is shown in red while the regulatory sequences are shown in black and the UTR in blue. The underlined sequences denote the -10 sequence. The arrow marks the point of a 5 base insertion...
Genetics! help please
May S Tae suumissis hot be accepted. 1. (10 points) A series of tRNAs have the anticodon sequences shown below Considering wobble, use Figure 13.12 to determine the possible codons with which each tRNA could pair Posible codons (Indicate the s end of each codon) Anticodon sequence 5-ACG-3 5'-xm UmGG-3 5'-IGA-3' Indicate which amino acid would be covalently bonded to tRNAs with the anticodon sequences given above. Use Table 13.1 to help you with your answer. Anticodon...
please help with this genetics question! i really need
help
1. Diagram a eukaryotic gene containing three exons and two introns. Your diagram should show DNA and the mature mRNA molecules. Show the following (if it exists in the DNA indicate so, if it exists in the mature mRNA, indicate so): a. AG and GU dinucleotides corresponding to intron-exon junctions b. +1 TSS C. 5' and 3' UTRS d. the start codon sequence e. the stop codon sequence f. the...
Below is the double-stranded DNA sequence of part of a hypothetical yeast genome, which happens to contain a very small gene. Transcription starts at the Transcription Start Site (TSS) after the promoter (shown in yellow), and proceeds in the direction of the arrow. Transcription stops at the end of the Transcription Terminator (shown in blue). 5' GTATAAATCCCTATGTTGACTTCAAAGGGCCCATGGAAGGGCTGATTCCTAAGA 3' 3' CATATTTAGGGATACAACTGAAGTTTCCCGGGTACCTTCCCGACTAAGGATTCT 5' a) Which strand of DNA shown, the top or the bottom, is the template strand? b) What is the...
A small portion of the human transport protein amino acid sequence is shown below. The upper sequence is associated with darker skin, and the lower sequence is associated with lighter skin. What DNA base-pair change created the light-skin form of the human protein from the gene that coded for the dark-skir form? Ala-Gly Ala ThrPhe Ala Gly-Thr-Thr - Phe SECOND BASE SUAU TI Phe TUUU UUC UUA UUG] TUCU UCC UCA UCG Ser (UAC LUGU) UGC UAA Stop UAG Stop...