Question

If you digested your vector with BamHI (G^GATCC), which of the following restriction enzymes could you...

If you digested your vector with BamHI (G^GATCC), which of the following restriction
enzymes could you use to digest genomic DNA to generate a library?

a. Acc65I (G^GTACC)
b. BglII (A^GATCC)
c. Sau3AI (^GATC)
d. a, b and c
e. b and c

0 0
Add a comment Improve this question Transcribed image text
Answer #1

BamHI results in a 5' G-GATCC 3' -G GATCC-

3' CCTAG-G 5' \rightarrow -CCTAG G-

Sau3AI results in a 5' NGATCN 3' -N GATCN-

3' NCTAGN 5' \rightarrow -NCTAG N-

As Sau3AI produces same sticky ends as BamHI , so Sau3AI will be used to digest genomic DNA to generate a library.

We were unable to transcribe this image

We were unable to transcribe this image

Add a comment
Know the answer?
Add Answer to:
If you digested your vector with BamHI (G^GATCC), which of the following restriction enzymes could you...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Suppose you digest the genomic DNA of a particular organism with the restriction enzyme SauA. Then...

    Suppose you digest the genomic DNA of a particular organism with the restriction enzyme SauA. Then you ligate the resulting fragment into a unique BamHI cloning site of a plasmid. The sequence of the restriction sites and position of cleavage is shown below Note: X and Y and their complementary bases Z and Y’ respectively can be any base (A,C, G, or T) 1) As you can see, ligation is possible because the two restriction enzymes produce compatible sticky ends....

  • Which of the following restriction enzymes do(es) generate sticky ends?                      A) Enzyme Recognition       &n

    Which of the following restriction enzymes do(es) generate sticky ends?                      A) Enzyme Recognition                      BamHI        G↓GATCC                                          CCTAG↑G                      B) Enzyme Recognition                      EcoRI          G↓AATTC                                           CTTAA↑G                      C) Enzyme Recognition                      HaeIII         GG↓CC                                           CC↑GG                      D) Enzyme Recognition                      HindIII       A↓AGCTT                                          TTCGA↑A                     E) all of the above, except c

  • You are using three restriction enzymes to digest a double-stranded DNA in which the sequence of...

    You are using three restriction enzymes to digest a double-stranded DNA in which the sequence of the upper strand is 5'-TTGTCGATGCGAATTCGGTGATGGATCCTAGGTCGTGTAGCATGCATGCCGGATCCTAGCTGAGC'-3. The recognition sites of the enzymes are G'AATTC (EcoRI), G'GATCC (BamHI), and GCATG'C (SphI). The cleavage sites are indicated with '. Determine how long the DNA fragments will be after digesting the DNA with each of these enzymes individually. Additionally, determine the length of the fragments if you digest with both enzymes BamHI and SphI. In a drawing, show...

  • You digest a 10Kb Linear ECoRI dna fragment with TWO restriction enzymes and obtain the following...

    You digest a 10Kb Linear ECoRI dna fragment with TWO restriction enzymes and obtain the following data Hind iii..... 3kb, 7kb BamHi ... 2 kb and 8kb HInd iii + bamHI ..... 1kb, 2kb, 7kb Draw a restriction map of this DNA fragment, labeling the sites for EcoRI, bahHI, and HIndiii

  • Easy question Given that a DNA fragment law the end (on right): Which one of the...

    Easy question Given that a DNA fragment law the end (on right): Which one of the following DNA ends is com, Place the following steps in chronological order when creating a tomato genomic DNA library. The available materials are DNA ligase, restriction enzyme, tomato leaves, plasmid DNK to act as vector that has already been digested with the restriction enzyme, competent bacteria, and nutrient agar plates containing ampicillin. You may use a step more than once. Add DNA ligase Transform...

  • You wake up one morning to your roommate exclaiming about her sudden hair growth. She has...

    You wake up one morning to your roommate exclaiming about her sudden hair growth. She has been supplementing her diet with a strange new fungus purchased at the local farmer's market. You take samples of the fungus to your lab and you find that this fungus does indeed make a protein (the harE protein) that stimulates hair growth. You construct a fungal genomic DNA library in the hope of cloning the harЕ gene. If you succeed you will be a...

  • You have cloned the Pepsi Gene into the vector pKEN. You used two restriction enzymes, BamHI...

    You have cloned the Pepsi Gene into the vector pKEN. You used two restriction enzymes, BamHI and EcoRI to force the cloning in a directional way. The plasmid (pKEN) is ~5 kb long and the insert Pepsi 800bp long. After transformation into E. coli you grow up several colonies and isolate the vector. After digestion of the vector it looks like you have three potential clones. You need to sequence the gene to make sure you have the correct clone....

  • Which of the following is not a use of restriction enzymes? A. Bacteria produce them to...

    Which of the following is not a use of restriction enzymes? A. Bacteria produce them to cut up foreign viral DNA B. Making recombinant DNA C. Cutting a vector when cloning a gene D. Replicating DNA during PCR

  • 1. A small piece of DNA was digested using restriction enzymes HindIII and PstI: A) How...

    1. A small piece of DNA was digested using restriction enzymes HindIII and PstI: A) How many basepairs long is the fragment? a. 900 bp b. 2000 bp c. 600 bp d. 500 bp B) How many PstI restriction sites are located within this fragment? a. 0 b. 3 c. 1 d. 4 e. 2 Psti Pstl Hindili 500 500 100 900

  • Restriction Mapping Below is a restriction map for the plasmid PGEN101 (total length - 20 kb)....

    Restriction Mapping Below is a restriction map for the plasmid PGEN101 (total length - 20 kb). Using this map as a guide, give the number of restriction fragments along with their associated lengths that would result from digesting PGEN101 with the restriction enzymes EcoRI, BamHII, anda combination of EcoRI + BamHI. BamHI BamHI BamHI / PGEN101 (20 kb) Mb EcoRI Digest Performed Size Emments Obtained EcoRI........ BamHI.. EcoRI + BamHI.... Two freshmen college students, interested in becoming gene jocks, performed...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT