Suppose you digest the genomic DNA of a particular organism with the restriction enzyme SauA. Then you ligate the resulting fragment into a unique BamHI cloning site of a plasmid. The sequence of the restriction sites and position of cleavage is shown below
Note: X and Y and their complementary bases Z and Y’
respectively can be any base (A,C, G, or T)
1) As you can see, ligation is possible because the two restriction
enzymes produce compatible sticky ends. What base should follow the
SauA site to reconstitute a BamHI site after ligation?(5 pts)
2) Assume that there are equal amounts of the four bases (A, C, G, and T) and the bases are randomly distributed in the genome. Calculate the probability to reconstitute both BamHI sites when a random DNA fragment digested by SauA is cloned into a plasmid linearized with BamHI.(5 pts)
Homework Answers
Request Answer!
We need at least 10 more requests to produce the answer.
0 / 10 have requested this problem solution
The more requests, the faster the answer.
Add Answer to:
Suppose you digest the genomic DNA of a particular organism with
the restriction enzyme SauA. Then...
You have cut genomic DNA with AvrII and wish to ligate it into pBluescript. However, there...
You have cut genomic DNA with AvrII and wish to ligate it into pBluescript. However, there is no AvrII site in the multiple cloning region of this plasmid. What other restriction enzyme could you use to cut the plasmid’s multiple cloning region that would produce compatible ends for ligation with your genomic DNA? (Hint: Look up the Compatible Cohesive Ends chart at New England Biolabs website and confer with pBluescript map) (1 point)
3. (2 pts.) You are sequencing the end of a genomic DNA fragment that was cut...
3. (2 pts.) You are sequencing the end of a genomic DNA fragment that was cut with the restriction enzyme BamH1 and ligated into a plasmid that was also cut with BamH1. You have denatured the DNA and annealed a labeled primer to plasmid sequences adjacent t<o the insertion site as shown below: 3' BamHi 5' GATCTAGCTAGCTAGCTAGCTAGCTAGCTAGCCATCGATGCTAGGAATCTTTGCTGATGCTAGTCGATGCCGTAGC ACTACGATCAGCTACGGC 3' 18 base primer 5' Next you add DNA polymerase, buffer, an excess of all four dNTPs, and a small amount of...
The PCR was a success and your target region of 440 bp in length has been amplified. You ligate a short linker containing an Apal restriction enzyme site onto both ends of the PCR product, dige...
The PCR was a success and your target region of 440 bp in length has been amplified. You ligate a short linker containing an Apal restriction enzyme site onto both ends of the PCR product, digest it with Apal, and clone it into the Apal site of the 5 kb plasmid diagrammed below amHI 300 EcoRI 5 kb 3400 1000 EcoRI 2000 Apal Draw the plasmid containing the cloned insert. Indicate clearly where the insert will be located. Include RE...
If the target DNA (the 3.266 Kb E. coli genomic Bam HI fragment) has the same restriction sites on each end, there are t...
If the target DNA (the 3.266 Kb E. coli genomic Bam HI fragment)
has the same restriction sites on each end, there are two possible
orientations for the target DNA to insert into the plasmid. The
following restriction enzymes would cut the 3.266 kb Bam HI genomic
fragment containing the RecA gene once or twice or not at all. In
the tables below, list the expected DNA fragment sizes for the two
possible orientations. Round the DNA fragment sizes to...
Question 4 C. Cloning and restriction enzyme digest Video aid 1: Plasmid cloning Video aid 2:...
Question 4
C. Cloning and restriction enzyme digest Video aid 1: Plasmid cloning Video aid 2: Restriction enzyme digest analysis The PCR was a success and your target region of 440 bp in length has been amplified. You igate a short linker containing an Apal restriction enzyme site onto both ends of the PCR product, digest it with Apal, and clone it into the Apal site of the 5 kb plasmid diagrammed below Bamll 300 EcoRI 3400 1000 2000 5...
1. If a restriction enzyme cuts a circular plasmid twice, how many fragments would you see...
1. If a restriction enzyme cuts a circular plasmid twice, how many fragments would you see on the gel? 2. How would you estimate the total number of base pairs in a plasmid by looking at the DNA fragments of the digested plasmid on a gel? 3. If a linear 1kb DNA fragment has a restriction site that is located 50 bp from one end of the plasmid, what would you expect to see if the digested and undigested DNA...
2 Addendum 1 to this lab provides information on the location of the EcoRI, and Sspl...
2 Addendum 1 to this lab provides information on the location of the EcoRI, and Sspl cut sites in your BlueScript vector and the 1.3 kb EcoRI fragment. Using this information, (a) draw the two possible restriction maps for the recombinant pBlueKan plasmid that you constructed (see below). There are two possible maps because the 1.3 kb fragment could have been cloned in either orientation relative to the vector, Next, (b) predict the sizes of the EcoRI. and Sspl frements...
If you cut the following single stranded DNA fragment with a restriction enzyme with restriction site...
If you cut the following single stranded DNA fragment with a restriction enzyme with restriction site of 5’GAATTC 3” and the cutting point between G and A. a. How many fragments you will get b. Specify the size (Number of bases) and the sequence of each fragment, pay attention to DNA direction (5’-3’) 5” ACATTGTCCGGGAATTC CGGGCTAGGCAT T GAATTGGAACA GAATTC GGGCCCGATCCGTA 3
9. On Worksheet 16.IIIB is a restriction map of bacteriophage lambda. You digest some lambda DNA...
9. On Worksheet 16.IIIB is a restriction map of bacteriophage lambda. You digest some lambda DNA with the enzymes BamHI and HindIII separately and then load the fragments into an agarose gel and perform electrophoresis. Next, you perform a Southern analysis using the 4,878-bp EcoRI lambda fragment as a probe. a. Draw a picture of the electrophoresis gel, using the outline of the stained electrophoresis gel in Worksheet 16.IIIB (the two smallest HindIII fragments will run off the gel.) b....
15. A new bacterial species was found and its DNA was analysed. It has a 50%...
15. A new bacterial species was found and its DNA was analysed. It has a 50% G+C content. Complete the table below by filling in the average length of restriction fragments expected from the genomic DNA (assuming a random distribution of bases) if it were digested with the following four restriction enzymes. (4 marks) The " symbol indicates the location of the cleavage site. Assume 50% G+C Restriction Enzyme Sequence recognized Average length of restriction fragment (base pairs) Msp 1...
3. (2 pts.) You are sequencing the end of a genomic DNA fragment that was cut with the restriction enzyme BamH1 and ligated into a plasmid that was also cut with BamH1. You have denatured the DNA and annealed a labeled primer to plasmid sequences adjacent t<o the insertion site as shown below: 3' BamHi 5' GATCTAGCTAGCTAGCTAGCTAGCTAGCTAGCCATCGATGCTAGGAATCTTTGCTGATGCTAGTCGATGCCGTAGC ACTACGATCAGCTACGGC 3' 18 base primer 5' Next you add DNA polymerase, buffer, an excess of all four dNTPs, and a small amount of...
The PCR was a success and your target region of 440 bp in length has been amplified. You ligate a short linker containing an Apal restriction enzyme site onto both ends of the PCR product, digest it with Apal, and clone it into the Apal site of the 5 kb plasmid diagrammed below amHI 300 EcoRI 5 kb 3400 1000 EcoRI 2000 Apal Draw the plasmid containing the cloned insert. Indicate clearly where the insert will be located. Include RE...
If the target DNA (the 3.266 Kb E. coli genomic Bam HI fragment)
has the same restriction sites on each end, there are two possible
orientations for the target DNA to insert into the plasmid. The
following restriction enzymes would cut the 3.266 kb Bam HI genomic
fragment containing the RecA gene once or twice or not at all. In
the tables below, list the expected DNA fragment sizes for the two
possible orientations. Round the DNA fragment sizes to...
Question 4
C. Cloning and restriction enzyme digest Video aid 1: Plasmid cloning Video aid 2: Restriction enzyme digest analysis The PCR was a success and your target region of 440 bp in length has been amplified. You igate a short linker containing an Apal restriction enzyme site onto both ends of the PCR product, digest it with Apal, and clone it into the Apal site of the 5 kb plasmid diagrammed below Bamll 300 EcoRI 3400 1000 2000 5...
2 Addendum 1 to this lab provides information on the location of the EcoRI, and Sspl cut sites in your BlueScript vector and the 1.3 kb EcoRI fragment. Using this information, (a) draw the two possible restriction maps for the recombinant pBlueKan plasmid that you constructed (see below). There are two possible maps because the 1.3 kb fragment could have been cloned in either orientation relative to the vector, Next, (b) predict the sizes of the EcoRI. and Sspl frements...
9. On Worksheet 16.IIIB is a restriction map of bacteriophage lambda. You digest some lambda DNA with the enzymes BamHI and HindIII separately and then load the fragments into an agarose gel and perform electrophoresis. Next, you perform a Southern analysis using the 4,878-bp EcoRI lambda fragment as a probe. a. Draw a picture of the electrophoresis gel, using the outline of the stained electrophoresis gel in Worksheet 16.IIIB (the two smallest HindIII fragments will run off the gel.) b....
15. A new bacterial species was found and its DNA was analysed. It has a 50% G+C content. Complete the table below by filling in the average length of restriction fragments expected from the genomic DNA (assuming a random distribution of bases) if it were digested with the following four restriction enzymes. (4 marks) The " symbol indicates the location of the cleavage site. Assume 50% G+C Restriction Enzyme Sequence recognized Average length of restriction fragment (base pairs) Msp 1...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 11 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 11 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 11 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 11 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 11 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 11 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 11 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 11 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 11 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 11 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 11 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 11 months ago