Question

If you cut the following single stranded DNA fragment with a restriction enzyme with restriction site...

If you cut the following single stranded DNA fragment with a restriction enzyme with restriction site of 5’GAATTC 3” and the cutting point between G and A.

a. How many fragments you will get

b. Specify the size (Number of bases) and the sequence of each fragment, pay attention to DNA direction (5’-3’)
5” ACATTGTCCGGGAATTC CGGGCTAGGCAT T GAATTGGAACA GAATTC GGGCCCGATCCGTA 3
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Answer:

There are two restriction enzyme cut sites for the target 5' GAATTC 3', in the given DNA sequence

5” ACATTGTCCGGGAATTC CGGGCTAGGCAT T GAATTGGAACA GAATTC GGGCCCGATCCGTA 3

As a rule, if in a linear DNA there are two recognition sites for a restriction enzyme, there will be N +1 fragments.

(1) Therefore, there will be 3 DNA fragment produced

(2) The length of the DNA fragment with sequence are

(i) ACATTGTCCGGG (12 nucleotides)

(ii) AATTC CGGGCTAGGCAT T GAATTGGAACA G (30 nucleotides)

(iii) AATTC GGGCCCGATCCGTA (19 nucleotides)

Add a comment
Know the answer?
Add Answer to:
If you cut the following single stranded DNA fragment with a restriction enzyme with restriction site...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 8. Draw chemical structure of a double strand DNA molecule of following DNA template S'CT3. Include...

    8. Draw chemical structure of a double strand DNA molecule of following DNA template S'CT3. Include the phosphodiester and all hydrogen bonds. (7) 9. If you cut the following double stranded DNA fragment with a restriction enzyme with restriction site of 5'GAATTC 3" and the cutting point between A and G. Draw the structure of resulting fragments. Specify and name the end of the fragments. (8) 5" ACCTTGTGAATTCTAGGCAT3 3' TGGAACACTTAAGATCCGTAS

  • 5. If you are digesting a large linear fragment that is 300,000 bp in length. How...

    5. If you are digesting a large linear fragment that is 300,000 bp in length. How many fragments would be produced if the DNA was digested by the following enzymes? Assume the fragment sizes are the average sizes calculated for a random DNA sequence. Use the information in the table from Question 3. Show your work. (A) Smal (B) Haelll (C) Noti Table 4.1 Recognition Sequences and Cutting Sites of Selected Restriction Endonucleases Enzyme Alul BamHI Bgli Clal ECORI Haelll...

  • RESTRICTION DIGEST ANALYSIS QUESTIONS(true or yes = A: false or no = b) 1. Larger DNA...

    RESTRICTION DIGEST ANALYSIS QUESTIONS(true or yes = A: false or no = b) 1. Larger DNA fragments appear near the bottom of the gel. 2. Larger DNA fragments move more rapidly through the gel. D ONA that has many restriction sites for a certain endonuclease will be cut into more fragmets than DNA with fewer restriction sites. 4. Cutting DNA with many different endonucleases will result in more DNA fragments. 5. Restriction enzymes all recognize the same base sequence when...

  • EcoRI is a common restriction enzyme used in cloning experiments. Its restriction sequence is G’AATTC. The...

    EcoRI is a common restriction enzyme used in cloning experiments. Its restriction sequence is G’AATTC. The strand is cut at the position of the apostrophe. The 50 base pair sequence shown below contains one or more EcoRI sites. Find them and circle them. Then count the resulting size (in base pairs – bp) of the DNA fragments (pieces) left over after using EcoRI to cut this DNA sequence. Circle the EcoRI sites in the sequence below. 1- ggagaattcgctgtacgaggttaaccccgatgccATGGCATGAATTCGTG -50 List...

  • Restriction Mapping of a Linear DNA • 2 DNA is a linear and double-stranded DNA isolated...

    Restriction Mapping of a Linear DNA • 2 DNA is a linear and double-stranded DNA isolated from bacteriophage lambda. This bacteriophage is a virus that infects E. coli and can undergo specialized transduction (see the transduction lab lecture). Assuming you obtained the following fragments from the restriction digestion. Draw the restriction map for the EcoRI and Hindi II enzymes in the 2. DNA. Fragment Size EcoRI 15300 6200 5250 2100 EcoRI + HindIII 15300 4400 4000 2100 1800 Hind!!! 17100...

  • Which of the following shows a double-stranded segment of DNA that might be cut by a...

    Which of the following shows a double-stranded segment of DNA that might be cut by a restriction enzyme? 5’ GACTGACT 3’ 3’ CTGACTGA 5’ 5’ GAGGAG 3’ 3’ CTCCTC 5’ 5’ GAATTC 3’ 3’ CTTAAG 5’

  • 7. Decide whether the DNA fragment shown below will be cut by the following restriction endonucleases:...

    7. Decide whether the DNA fragment shown below will be cut by the following restriction endonucleases: EcoRI (5’-GAATTC-3’), AluI (5’-AGCT-3’), PstI (5’-CTGCAG-3’). For each one that cuts, how many products will be produced? 5’-AAGAATTGCGGAATTCGAGCTTAAGGGCCGCGCCGAAGCTTTAAA-3’ 3’-TTCTTAACGCCTTAAGCTCGAATTCCCGGCGCGGCTTCGAAATTT-5’

  • 1. A circular plasmid has two PmeI restriction sites. A PmeI restriction enzyme will cut this...

    1. A circular plasmid has two PmeI restriction sites. A PmeI restriction enzyme will cut this plasmid into two fragments. A. True B. False 2.In general, restriction enzymes that recognize four nucleotides have higher probability to produce more DNA fragments than those enzymes that recognize six nucleotides. A. true B. false 3. Which of the following sequences are palindromes? A. 5' TGGCCA 3' B. 5' GAAAAG 3' C. 5' CGATGG 3' D. 5' GACGAC 3' 4. Below are the possible...

  • 3. (2 pts.) You are sequencing the end of a genomic DNA fragment that was cut...

    3. (2 pts.) You are sequencing the end of a genomic DNA fragment that was cut with the restriction enzyme BamH1 and ligated into a plasmid that was also cut with BamH1. You have denatured the DNA and annealed a labeled primer to plasmid sequences adjacent t<o the insertion site as shown below: 3' BamHi 5' GATCTAGCTAGCTAGCTAGCTAGCTAGCTAGCCATCGATGCTAGGAATCTTTGCTGATGCTAGTCGATGCCGTAGC ACTACGATCAGCTACGGC 3' 18 base primer 5' Next you add DNA polymerase, buffer, an excess of all four dNTPs, and a small amount of...

  • Suppose you digest the genomic DNA of a particular organism with the restriction enzyme SauA. Then...

    Suppose you digest the genomic DNA of a particular organism with the restriction enzyme SauA. Then you ligate the resulting fragment into a unique BamHI cloning site of a plasmid. The sequence of the restriction sites and position of cleavage is shown below Note: X and Y and their complementary bases Z and Y’ respectively can be any base (A,C, G, or T) 1) As you can see, ligation is possible because the two restriction enzymes produce compatible sticky ends....

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT