Question

EcoRI is a common restriction enzyme used in cloning experiments. Its restriction sequence is G’AATTC. The...

  1. EcoRI is a common restriction enzyme used in cloning experiments. Its restriction sequence is G’AATTC. The strand is cut at the position of the apostrophe. The 50 base pair sequence shown below contains one or more EcoRI sites. Find them and circle them. Then count the resulting size (in base pairs – bp) of the DNA fragments (pieces) left over after using EcoRI to cut this DNA sequence.

Circle the EcoRI sites in the sequence below.

1- ggagaattcgctgtacgaggttaaccccgatgccATGGCATGAATTCGTG -50

List the sizes (in number of bases) of each fragment that would result from digestion with EcoRI.

Hint: Your total size of all your fragments should still produce a sum 50 bp. Bases are not removed when cut by a restriction enzyme.

0 0
Add a comment Improve this question Transcribed image text
Answer #1

The fragment has two EcoRI restriction sites, shown in bold. The position where the DNA molecule will be cut is also indicated.

GGAG/AATTCGCTGTACGAGGTTAACCCCGATGCCATGGCATG/AATTCGTG

The fragments generated are:
4bp --> GGA
8bp --> AATTCGTG
38bp --> AATTCGCTGTACGAGGTTAACCCCGATGCCATGGCATG

Add a comment
Know the answer?
Add Answer to:
EcoRI is a common restriction enzyme used in cloning experiments. Its restriction sequence is G’AATTC. The...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • One strand of a DNA sequences is given below. Find the EcoRI sites and indicate the...

    One strand of a DNA sequences is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...

  • 1. A circular plasmid has two PmeI restriction sites. A PmeI restriction enzyme will cut this...

    1. A circular plasmid has two PmeI restriction sites. A PmeI restriction enzyme will cut this plasmid into two fragments. A. True B. False 2.In general, restriction enzymes that recognize four nucleotides have higher probability to produce more DNA fragments than those enzymes that recognize six nucleotides. A. true B. false 3. Which of the following sequences are palindromes? A. 5' TGGCCA 3' B. 5' GAAAAG 3' C. 5' CGATGG 3' D. 5' GACGAC 3' 4. Below are the possible...

  • For each problem draw each digest listed as well as a final figure with each restriction...

    For each problem draw each digest listed as well as a final figure with each restriction site indicated 1. Construct a restriction map of a linear fragment of DNA, using the following data. Your map should indicate the relative positions of the restriction sites along with distances from the ends of the molecule to the restriction sites and between restriction sites: DNA Sizes of Fragments (bp) uncut DNA: 10,000 DNA cut with EcoRI: 8000, 2000 DNA cut with BamHI: 5000,...

  • Question 4 C. Cloning and restriction enzyme digest Video aid 1: Plasmid cloning Video aid 2:...

    Question 4 C. Cloning and restriction enzyme digest Video aid 1: Plasmid cloning Video aid 2: Restriction enzyme digest analysis The PCR was a success and your target region of 440 bp in length has been amplified. You igate a short linker containing an Apal restriction enzyme site onto both ends of the PCR product, digest it with Apal, and clone it into the Apal site of the 5 kb plasmid diagrammed below Bamll 300 EcoRI 3400 1000 2000 5...

  • 2 Addendum 1 to this lab provides information on the location of the EcoRI, and Sspl...

    2 Addendum 1 to this lab provides information on the location of the EcoRI, and Sspl cut sites in your BlueScript vector and the 1.3 kb EcoRI fragment. Using this information, (a) draw the two possible restriction maps for the recombinant pBlueKan plasmid that you constructed (see below). There are two possible maps because the 1.3 kb fragment could have been cloned in either orientation relative to the vector, Next, (b) predict the sizes of the EcoRI. and Sspl frements...

  • The following is a small part of a vector DNA sequence showing the NdeI and SacII...

    The following is a small part of a vector DNA sequence showing the NdeI and SacII cut sites.  The bases recognizedby the enzymes are in bold. They both are Class II restriction enzymes. These enzymes recognize a specific sequence of palindromic bases, i.e., reads the same on both strands    1. When you cut this DNA, shown in the figure above, by NdeI, it will generate sticky ends. Write the two pieces of DNA that will result after NdeI digestion and...

  • Restriction Mapping of a Linear DNA • 2 DNA is a linear and double-stranded DNA isolated...

    Restriction Mapping of a Linear DNA • 2 DNA is a linear and double-stranded DNA isolated from bacteriophage lambda. This bacteriophage is a virus that infects E. coli and can undergo specialized transduction (see the transduction lab lecture). Assuming you obtained the following fragments from the restriction digestion. Draw the restriction map for the EcoRI and Hindi II enzymes in the 2. DNA. Fragment Size EcoRI 15300 6200 5250 2100 EcoRI + HindIII 15300 4400 4000 2100 1800 Hind!!! 17100...

  • If you cut the following single stranded DNA fragment with a restriction enzyme with restriction site...

    If you cut the following single stranded DNA fragment with a restriction enzyme with restriction site of 5’GAATTC 3” and the cutting point between G and A. a. How many fragments you will get b. Specify the size (Number of bases) and the sequence of each fragment, pay attention to DNA direction (5’-3’) 5” ACATTGTCCGGGAATTC CGGGCTAGGCAT T GAATTGGAACA GAATTC GGGCCCGATCCGTA 3

  • please help me with these questions Lab 8 Extension Activity: Plasmid Mapping and Restriction Enzymes Mapping...

    please help me with these questions Lab 8 Extension Activity: Plasmid Mapping and Restriction Enzymes Mapping the Plasmid The first step in mapping a plasmid is to determine how many times a restriction site is found on that plasmid. Examine the results for plasmid 55 as an example. The data given in the following table are for the double digest using EcoRI and Pstl. Also, giving are the data for single digests by the individual enzymes. The numbers in the...

  • A linear DNA molecule that is 3250 bp long is digested with restriction enzyme A alone,...

    A linear DNA molecule that is 3250 bp long is digested with restriction enzyme A alone, restriction enzyme B alone, or a combination of enzymes A and B to produce the following fragment sizes. Construct a restriction map of the DNA fragment. How many times does enzyme A cut the linear DNA molecule? If you are unable to place both enzymes A and B on the map, show one possible arrangement of enzyme A cognition sites on the DNA molecule.

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT