For each problem draw each digest listed as well as a final figure with each restriction site indicated
1. Construct a restriction map of a linear fragment of DNA, using the following data. Your map
should indicate the relative positions of the restriction sites along with distances from the ends of
the molecule to the restriction sites and between restriction sites:
DNA
Sizes of Fragments (bp)
uncut DNA:
10,000
DNA cut with EcoRI:
8000, 2000
DNA cut with BamHI:
5000, 5000
DNA cut with EcoRI + BamHI:
5000, 3000, 2000
For each problem draw each digest listed as well as a final figure with each restriction...
construct a restriction of a circular pvn plasmid, using the following data yor map should indicale, either the relative positions of each restriction site or give the distances between the restriction J DNA sizes of fragments ( bp) uncut DNA 112000 PNA cut with sma I 12000 DNA cut with Hind III 2000 PNA cut with ECORI 12000 onn cut with sma I FEcori 7000, 5000 ana cut with SMO I + HINDIII 10.000, 2000 min cut with Hind II...
The figure below shows a restriction map of a segment of a DNA molecule. Eco refers to locations where the restriction endonuclease EcoRI cuts the DNA, and Pst refers to locations where the restriction enzyme Pst cuts the DNA. Potential restriction sites are numbered 1-6. Distances between restriction sites are shown on the bottom scale in base pairs (bp). The thick line represents the part of the molecule that has homology with a probe. Eco Pst Eco Pst Eco Pst...
9. On Worksheet 16.IIIB is a restriction map of bacteriophage lambda. You digest some lambda DNA with the enzymes BamHI and HindIII separately and then load the fragments into an agarose gel and perform electrophoresis. Next, you perform a Southern analysis using the 4,878-bp EcoRI lambda fragment as a probe. a. Draw a picture of the electrophoresis gel, using the outline of the stained electrophoresis gel in Worksheet 16.IIIB (the two smallest HindIII fragments will run off the gel.) b....
The PCR was a success and your target region of 440 bp in length has been amplified. You ligate a short linker containing an Apal restriction enzyme site onto both ends of the PCR product, digest it with Apal, and clone it into the Apal site of the 5 kb plasmid diagrammed below amHI 300 EcoRI 5 kb 3400 1000 EcoRI 2000 Apal Draw the plasmid containing the cloned insert. Indicate clearly where the insert will be located. Include RE...
Restriction Mapping Below is a restriction map for the plasmid PGEN101 (total length - 20 kb). Using this map as a guide, give the number of restriction fragments along with their associated lengths that would result from digesting PGEN101 with the restriction enzymes EcoRI, BamHII, anda combination of EcoRI + BamHI. BamHI BamHI BamHI / PGEN101 (20 kb) Mb EcoRI Digest Performed Size Emments Obtained EcoRI........ BamHI.. EcoRI + BamHI.... Two freshmen college students, interested in becoming gene jocks, performed...
You digest a 10Kb Linear ECoRI dna fragment with TWO restriction enzymes and obtain the following data Hind iii..... 3kb, 7kb BamHi ... 2 kb and 8kb HInd iii + bamHI ..... 1kb, 2kb, 7kb Draw a restriction map of this DNA fragment, labeling the sites for EcoRI, bahHI, and HIndiii
The PCR was a success and your target region of 770 bp in length has been amplified. You now plan to digest the DNA amplicon with the restriction enzyme Eael, and clone the resulting longest fragment it into the Eael site of the 5 kb plasmid diagrammed below. 770 bp BamHI 1 200 EcoRI 800 EcoRI 4000 1000 5 kb O /1000 2000 2000 Faal You purify your recombinant plasmid from bacterial cells, and run the plasmid (uncut. or not...
UuOU Wuuur 3. Complete the table below to show your anticipated results, when digesting the recombinant plasmid containing the PCR fragment with the different restriction enzymes as listed. Recombinant plasmid Restriction enzyme No. of cuts Fragment sizes EcoRI BamHI Eael EcoRI + BamHI +Eae 1 -teamHI EcoRI 4000 EcoRI 6k6 1000 2000 es Target region of 770 bp in length has been amplified Plan to digest the DNA amplican with restrictch enzyme Egel, and clone the resulting longest fragment into...
EcoRI is a common restriction enzyme used in cloning experiments. Its restriction sequence is G’AATTC. The strand is cut at the position of the apostrophe. The 50 base pair sequence shown below contains one or more EcoRI sites. Find them and circle them. Then count the resulting size (in base pairs – bp) of the DNA fragments (pieces) left over after using EcoRI to cut this DNA sequence. Circle the EcoRI sites in the sequence below. 1- ggagaattcgctgtacgaggttaaccccgatgccATGGCATGAATTCGTG -50 List...
You are using three restriction enzymes to digest a double-stranded DNA in which the sequence of the upper strand is 5'-TTGTCGATGCGAATTCGGTGATGGATCCTAGGTCGTGTAGCATGCATGCCGGATCCTAGCTGAGC'-3. The recognition sites of the enzymes are G'AATTC (EcoRI), G'GATCC (BamHI), and GCATG'C (SphI). The cleavage sites are indicated with '. Determine how long the DNA fragments will be after digesting the DNA with each of these enzymes individually. Additionally, determine the length of the fragments if you digest with both enzymes BamHI and SphI. In a drawing, show...