Question

The following is a small part of a vector DNA sequence showing the NdeI and SacII cut sites.  The bases recognizedby the enzymes are in bold. They both are Class II restriction enzymes. These enzymes recognize a specific sequence of palindromic bases, i.e., reads the same on both strands   

Ndel SacII AGTCATATGGACCGCGGCGG TCAGTATACCTGGCGCCGCC Ndel SacII

1. When you cut this DNA, shown in the figure above, by NdeI, it will generate sticky ends. Write the two pieces of DNA that will result after NdeI digestion and underline the overhangs.          

2. When you cut this DNA, shown in the figure above, by SacII, it will generate sticky ends. Write the two pieces of DNA that will result after SacII digestion and underline the overhangs.

3. After NdeI digestion as shown above in ‘A’, the DNA fragments are treated with Klenow fragment.  Write the two pieces of DNA that will result after reactions with Klenow fragment.                                                           

4. After SacII digestion as shown above in ‘B’, the DNA fragments are treated with Klenow fragment.  Write the two pieces of DNA that will result after reactions with Klenow fragment.           

Answer 1

Answer has been attached below as image. Hope this will help

(Page No Nde I ore 18 ) S NGT CATATGGACCAGGCGG 31 TCA Caтaтa cc 1 Gasic бас со ссу NdeI Su от этся 3 TeTG GAcco CGmc GG3) 2. Тc ACTAI ACCT GG C Gmc checs) 3 31 Oversings с H& TCO тит 64 CG GC 4GCG Gј з 31 TCAGTATA ICCtla G Gledleds Soe li digestun А огCefeтo, Accoc Cococco 6, 31 2. Своге TACCThe CC СССccs 3.

o Woer digestion S'AGTCA TATGGA CCGCGGCGGBI 3T CA Cn1 г ACCT G,C, CC, с соседи Klenow fruit 31+ 31 polly peren fill the gup auturity S' AGT CATA STATGGA CCGC GGC GG 31 г г в Атесст Со СС Сс Соссю Cg Soc la dyst S AGTCAT ATCGacendo anchez 3. Т4fPTAC C7CC d ccco Ccs, I Klenow fogaza ziz exo nuleen acties STACTLYAT ATGAcco G, со 31 сестетесст Сс Со се у