Q.1. Answer- B
Explanation- larger DNA fragments appear near the well and away from bottom because size of DNA is directly proportional to its movement in electric field. Larger the size then it will move slowly and smaller the size it will move faster in agarose gel.
Q.2. Answer- B
Explanation- larger DNA fragments move slowly through agarose gel because small DNA fragments move easily through pores of agarose gel but larger fragments can not.
Q.3. Answer- A
Explanation- DNA that has many restriction sites for a certain endonuclease will be cut into more fragments than the DNA with fewer restriction sites. DNA that has more restriction sites then the specific restriction endonuclease cleaves at that sites and we will get more fragments but if DNA has few sites then we will get few fragments as restriction sites are few and restriction enzymes are specific for cleavage at specific site.
Q.4. Answer- A
Explanation- If DNA is cut by using many restriction endonuclease then we will get many DNA fragments because DNA has many restriction sites for different endonuclease and by using many restriction enzymes DNA is cleaved at many sites and we will get more DNA fragments.
RESTRICTION DIGEST ANALYSIS QUESTIONS(true or yes = A: false or no = b) 1. Larger DNA...
You are using three restriction enzymes to digest a double-stranded DNA in which the sequence of the upper strand is 5'-TTGTCGATGCGAATTCGGTGATGGATCCTAGGTCGTGTAGCATGCATGCCGGATCCTAGCTGAGC'-3. The recognition sites of the enzymes are G'AATTC (EcoRI), G'GATCC (BamHI), and GCATG'C (SphI). The cleavage sites are indicated with '. Determine how long the DNA fragments will be after digesting the DNA with each of these enzymes individually. Additionally, determine the length of the fragments if you digest with both enzymes BamHI and SphI. In a drawing, show...
Why do restriction enzymes need to be kept on ice? What order should the DNA, enzyme, water and buffer be added to the microcentrifuge tube for a restriction digest? If lambda DNA is linear, how many times would the enzyme have to cut the DNA to generate five DNA fragments? Would a shorter DNA fragment move faster or slower through the agarose gel than a longer fragment? Why?
on the me but not with the larger fragments on o t and more and record med in the h 3. Determine the distracted for each bund data bere 4. Determine the distance traveled for each and generated in the double digest and record data bere tion Endonuclease Digestion and Gel Electrophoresis of DNA 185 VI. RESTRICTION MAPPING The different DNA fragments generated by different map DNA. For example, specific DNA on 2000 nucleotides in las Rl or Hind and...
9. On Worksheet 16.IIIB is a restriction map of bacteriophage lambda. You digest some lambda DNA with the enzymes BamHI and HindIII separately and then load the fragments into an agarose gel and perform electrophoresis. Next, you perform a Southern analysis using the 4,878-bp EcoRI lambda fragment as a probe. a. Draw a picture of the electrophoresis gel, using the outline of the stained electrophoresis gel in Worksheet 16.IIIB (the two smallest HindIII fragments will run off the gel.) b....
One strand of a DNA sequences is given below. Find the
EcoRI sites and indicate the cutting site with an arrow. Count the
number of bases in each fragment.
CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...
can
someone explain throughly on how to find a-c??? thanks!!!
The following question will provide practice in interpreting and analyzing gel results. 5. You obtained the DNA electrophoresis gel below. Three samples of lambda phage DNA were digested with 3 different restriction enzymes and the digested DNA was applied to the gel in lane 4 and the bands were visualized. The Hind Ill digest was used as a molecular weight standard marker and produced 6 DNA fragments of known size:...
Hi I have a problem with number 5, it involves gel
analysis results. There are 2 parts, a,b,c. For A Im sure you need
to make a graph with distance in (cm) on the vertical axis and
log10 bp on the horitzontal. I need help figuring out where to
start and what to do. Please help!
The following question will provide practice in interpreting and analyzing gel results You obtained the DNA electrophoresis gel below. Three samples of lambda phage...
True or false? Restriction digestion is required for PCR amplifying DNA. Ampicillin is a gene that encodes for ampicillin resistance. The ends produced by the endonuclease can be rejoined by a ligase, which closes the break in the hydrogen bonds formed by the complementary DNA nucleotides. Restriction recognition sites typically have a palindrome structure. During DNA ligation, DNA fragments with compatible sticky ends have a higher ligation efficiency than DNA fragments with blunt ends. PCR is a technique used to...
DNA fragments with the same number of nucleotides will move through the gel at different speeds ? True or False?
1. A circular plasmid has two PmeI restriction sites. A PmeI restriction enzyme will cut this plasmid into two fragments. A. True B. False 2.In general, restriction enzymes that recognize four nucleotides have higher probability to produce more DNA fragments than those enzymes that recognize six nucleotides. A. true B. false 3. Which of the following sequences are palindromes? A. 5' TGGCCA 3' B. 5' GAAAAG 3' C. 5' CGATGG 3' D. 5' GACGAC 3' 4. Below are the possible...