Question

on the me but not with the larger fragments on o t and more and record med in the h 3. Determine the distracted for each bund
tion Endonuclease Digestion and Gel Electrophoresis of DNA 185 VI. RESTRICTION MAPPING The different DNA fragments generated
186 Restriction Endonuclease Digestion and Gel Electrophoresis on overlaps by 100 base pairs the Hind III 600 fragment and ov
Restriction Endonuclease Digestion and on Endonuclease Digestionar electrophoresis of DNA 183 ULLO LITT 1 2 3 4 5 6 LANE FIGU
0 0
Add a comment Improve this question Transcribed image text
Request Professional Answer

Request Answer!

We need at least 10 more requests to produce the answer.

0 / 10 have requested this problem solution

The more requests, the faster the answer.

Request! (Login Required)


All students who have requested the answer will be notified once they are available.
Know the answer?
Add Answer to:
on the me but not with the larger fragments on o t and more and record...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Similar Homework Help Questions
  • can someone explain throughly on how to find a-c??? thanks!!! The following question will provide practice in interpreting and analyzing gel results. 5. You obtained the DNA electrophoresis gel be...

    can someone explain throughly on how to find a-c??? thanks!!! The following question will provide practice in interpreting and analyzing gel results. 5. You obtained the DNA electrophoresis gel below. Three samples of lambda phage DNA were digested with 3 different restriction enzymes and the digested DNA was applied to the gel in lane 4 and the bands were visualized. The Hind Ill digest was used as a molecular weight standard marker and produced 6 DNA fragments of known size:...

  • RESTRICTION DIGEST ANALYSIS QUESTIONS(true or yes = A: false or no = b) 1. Larger DNA...

    RESTRICTION DIGEST ANALYSIS QUESTIONS(true or yes = A: false or no = b) 1. Larger DNA fragments appear near the bottom of the gel. 2. Larger DNA fragments move more rapidly through the gel. D ONA that has many restriction sites for a certain endonuclease will be cut into more fragmets than DNA with fewer restriction sites. 4. Cutting DNA with many different endonucleases will result in more DNA fragments. 5. Restriction enzymes all recognize the same base sequence when...

  • Hi I have a problem with number 5, it involves gel analysis results. There are 2 parts, a,b,c. For A Im sure you need to make a graph with distance in (cm) on the vertical axis and log10 bp on the hor...

    Hi I have a problem with number 5, it involves gel analysis results. There are 2 parts, a,b,c. For A Im sure you need to make a graph with distance in (cm) on the vertical axis and log10 bp on the horitzontal. I need help figuring out where to start and what to do. Please help! The following question will provide practice in interpreting and analyzing gel results You obtained the DNA electrophoresis gel below. Three samples of lambda phage...

  • Hi can someone help me understand part C and why the drawn in red lines are...

    Hi can someone help me understand part C and why the drawn in red lines are where they are. Basically from the bp given how can I go back to cm so I can drawn them into the picture provided? Do not need help with A or B. The following question will provide practice in interpreting and analyzing gel results You obtained the DNA electrophoresis gel below. Three samples of lambda phage DNA were digested with 3 different restriction enzymes...

  • One strand of a DNA sequences is given below. Find the EcoRI sites and indicate the...

    One strand of a DNA sequences is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...

  • Use the following depiction of a gel of Hind III fragments to answer the questions: 1...

    Use the following depiction of a gel of Hind III fragments to answer the questions: 1 Kb Ladder Possible Hind III Fragments: 1 Kb Ladder Sizes 10,000 8,000 564 bp 8,888 2.0 kb 2.3 kb 11 4.36 kb 4,000 3,000 2,500 2,000 1,500 6.5 kb 9.4 kb 23 kb 1,000 750 500 250 1. Based on the gel results, list the sizes of the chromosome fragments cloned: 2. Based on the gel results, list the sizes of the chromosome fragments...

  • Suppose you are going to do a restriction digest with a plasmid, using the restriction enzyme...

    Suppose you are going to do a restriction digest with a plasmid, using the restriction enzyme Eco R1. A map of the plasmid is shown here. The entire plasmid is 6000 bp, and there are Eco R1 restriction sites at 1500 bp, 2000 bp, and 4000 bp. You’re going to run the entire volume of the digest on a gel, and you want to cut just enough DNA to have 50 ng in the smallest band on your gel. Starting...

  • The figure below shows a restriction map of a segment of a DNA molecule. Eco refers...

    The figure below shows a restriction map of a segment of a DNA molecule. Eco refers to locations where the restriction endonuclease EcoRI cuts the DNA, and Pst refers to locations where the restriction enzyme Pst cuts the DNA. Potential restriction sites are numbered 1-6. Distances between restriction sites are shown on the bottom scale in base pairs (bp). The thick line represents the part of the molecule that has homology with a probe. Eco Pst Eco Pst Eco Pst...

  • 9. On Worksheet 16.IIIB is a restriction map of bacteriophage lambda. You digest some lambda DNA...

    9. On Worksheet 16.IIIB is a restriction map of bacteriophage lambda. You digest some lambda DNA with the enzymes BamHI and HindIII separately and then load the fragments into an agarose gel and perform electrophoresis. Next, you perform a Southern analysis using the 4,878-bp EcoRI lambda fragment as a probe. a. Draw a picture of the electrophoresis gel, using the outline of the stained electrophoresis gel in Worksheet 16.IIIB (the two smallest HindIII fragments will run off the gel.) b....

  • III. Subclone the gene into plasmid, extract the plasmid DNA. 5. You know that your insert...

    III. Subclone the gene into plasmid, extract the plasmid DNA. 5. You know that your insert (gene of interest, GOI) is flanked by the EcoRI sites, which makes this restriction enzyme a perfect candidate to cut out your gene. You also know that the GOI has a unique BamH1 restriction site. After subcloning the PCR product into the plasmid, a purified DNA preparation of the plasmid is digested to completion with BamHI restriction endonuclease. In separate reactions, the same preparation...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT