QUESTION 1
Why do restriction enzymes need to be kept on ice?
In this context, remember that enzymes are proteins and like all
proteins are very sensitive to the temperature and pH. If the
restriction enzyme is placed under high temperatures it could be
denatured and it wont be able to accomplish the reaction. So, one
way to conserve the structure and functional capacity of all
enzymes (not only restriction enzymes) is to keep them on ice,
until they are ready to be used in the experiment.
Note: According to Chegg’s guidelines, you have to send just one question. Please, send each question separate so all experts can answer each of your questions. Thank you!.
Why do restriction enzymes need to be kept on ice? What order should the DNA, enzyme,...
RESTRICTION DIGEST ANALYSIS QUESTIONS(true or yes = A: false or no = b) 1. Larger DNA fragments appear near the bottom of the gel. 2. Larger DNA fragments move more rapidly through the gel. D ONA that has many restriction sites for a certain endonuclease will be cut into more fragmets than DNA with fewer restriction sites. 4. Cutting DNA with many different endonucleases will result in more DNA fragments. 5. Restriction enzymes all recognize the same base sequence when...
What are restriction enzymes and how do they affect DNA? Why do some fragments move quickly and some move slowly through an agarose gel? How can type II restriction enzymes and agarose gels be used to identify samples from individuals with the similar DNA sequence?
1. A circular plasmid has two PmeI restriction sites. A PmeI restriction enzyme will cut this plasmid into two fragments. A. True B. False 2.In general, restriction enzymes that recognize four nucleotides have higher probability to produce more DNA fragments than those enzymes that recognize six nucleotides. A. true B. false 3. Which of the following sequences are palindromes? A. 5' TGGCCA 3' B. 5' GAAAAG 3' C. 5' CGATGG 3' D. 5' GACGAC 3' 4. Below are the possible...
Suppose you are going to do a restriction digest with a plasmid, using the restriction enzyme Eco R1. A map of the plasmid is shown here. The entire plasmid is 6000 bp, and there are Eco R1 restriction sites at 1500 bp, 2000 bp, and 4000 bp. You’re going to run the entire volume of the digest on a gel, and you want to cut just enough DNA to have 50 ng in the smallest band on your gel. Starting...
One strand of a DNA sequences is given below. Find the
EcoRI sites and indicate the cutting site with an arrow. Count the
number of bases in each fragment.
CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...
A restriction map lists the
locations of DNA sequences that are cut by a particular restriction
enzyme for a piece of DNA, such as a chromosome or a plasmid.
Restriction maps are important when generating a construct for
experimental use. Digesting the DNA sequence with the restriction
enzymes will result in fragmented DNA of predictable sizes, based
on the restriction map, that allow a researcher to analyze if his
or her construct was generated correctly when visualized using gel
electrophoresis....
A. Your lab To see if you understand what you did in our lab, answer the following based in the procedures for the restriction digest and the gel electrophoresis. 1. Using the PGLO map on p7 of the gel electrophoresis procedure, predict the size of the fragments generated by each enzyme EcoRI Hindill, and Pst! (the sizes you would expect to see on the gel.) (6 pts) Hindill -8 fragments were produced by the restriction enzyme. 2. Answer the calculation...
9. On Worksheet 16.IIIB is a restriction map of bacteriophage lambda. You digest some lambda DNA with the enzymes BamHI and HindIII separately and then load the fragments into an agarose gel and perform electrophoresis. Next, you perform a Southern analysis using the 4,878-bp EcoRI lambda fragment as a probe. a. Draw a picture of the electrophoresis gel, using the outline of the stained electrophoresis gel in Worksheet 16.IIIB (the two smallest HindIII fragments will run off the gel.) b....
5. You have a linear DNA fragment and you wish to generate a restriction map using Mstl and EcoR1. When the framgent is digested with Mst1 and the DNA is run on a gel you observe a 4kb and a 6kb fragment. When the DNA is digested with EcoR1, 1kb, 4kb and 5kb fragments are generated, A double digest using both enzymes produce 1kb, 2kb, 3kb and 4kb fragments. Explain these results and draw a restirction map consistent with these...
can
someone explain throughly on how to find a-c??? thanks!!!
The following question will provide practice in interpreting and analyzing gel results. 5. You obtained the DNA electrophoresis gel below. Three samples of lambda phage DNA were digested with 3 different restriction enzymes and the digested DNA was applied to the gel in lane 4 and the bands were visualized. The Hind Ill digest was used as a molecular weight standard marker and produced 6 DNA fragments of known size:...