Question

What are restriction enzymes and how do they affect DNA? Why do some fragments move quickly...

What are restriction enzymes and how do they affect DNA? Why do some fragments move quickly and some move slowly through an agarose gel? How can type II restriction enzymes and agarose gels be used to identify samples from individuals with the similar DNA sequence?

0 0
Add a comment Improve this question Transcribed image text
Answer #1

1. Restriction enzymes are a special class of enzymes that can cut the DNA into fragments at specific locations called restriction sites. This is a defense mechanism employed by bacteria for protection against viral DNA or genetic code. They can cut the DNA into several fragments thereby affecting its activity.

2. DNA fragments are negatively charged, so they move towards the positive electrode. Because all DNA fragments have the same amount of charge per mass, small fragments move through the gel faster than large ones. Basically the movement through the gel is size-dependent.

3. Restriction enzymes recognize specific sequences of nucleotides in a DNA strand. Their use allows the detection of specific sequences of DNA. Since the DNA sequences are similar they will be os similar size and will be appeared at the same location in front of specific band length.

Add a comment
Know the answer?
Add Answer to:
What are restriction enzymes and how do they affect DNA? Why do some fragments move quickly...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Why do restriction enzymes need to be kept on ice? What order should the DNA, enzyme,...

    Why do restriction enzymes need to be kept on ice? What order should the DNA, enzyme, water and buffer be added to the microcentrifuge tube for a restriction digest? If lambda DNA is linear, how many times would the enzyme have to cut the DNA to generate five DNA fragments? Would a shorter DNA fragment move faster or slower through the agarose gel than a longer fragment? Why?

  • One strand of a DNA sequences is given below. Find the EcoRI sites and indicate the...

    One strand of a DNA sequences is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...

  • Chromosomal and plasmid DNA can be cut into manageable pieces by restriction enzymes. Using agarose gel...

    Chromosomal and plasmid DNA can be cut into manageable pieces by restriction enzymes. Using agarose gel electrophoresis, the DNA fragments can be separated on a gel, based on their lengths. In order to see the fragments, a stain is typically added to the gel. The size of each fragment can be determined by comparing each one to a DNA molecular weight marker of known size. Below is a map of pBR22 plasmid. The position and base pair number of the...

  • A. Your lab To see if you understand what you did in our lab, answer the...

    A. Your lab To see if you understand what you did in our lab, answer the following based in the procedures for the restriction digest and the gel electrophoresis. 1. Using the PGLO map on p7 of the gel electrophoresis procedure, predict the size of the fragments generated by each enzyme EcoRI Hindill, and Pst! (the sizes you would expect to see on the gel.) (6 pts) Hindill -8 fragments were produced by the restriction enzyme. 2. Answer the calculation...

  • The picture above represents an agarose gel that was used to analyze plasmid DNA after it...

    The picture above represents an agarose gel that was used to analyze plasmid DNA after it was cut with the restriction enzyme HindIll. The plasmid was incubated with Hindill until all of the available Hindlll cut sites were cut by HindIll. After running the sample on the gel, three bands were detected (Note that there are three wells shown at the top of the gel for loading samples, however, only the middle well was loaded with sample). Based on this...

  • Question 2: EcoRI, EcoRII, and EcoRV are all restriction enzymes found in E.coli. How does E.coli...

    Question 2: EcoRI, EcoRII, and EcoRV are all restriction enzymes found in E.coli. How does E.coli prevent these enzymes from digesting its own DNA? Question 3: When performing a restriction digest it is necessary to incubate the enzymes and the DNA together to give the enzymes time to work. Given that we're using enzymes isolated from E.coli, a human symbiont, what temperature would you incubate the enzymes at, and why? Question 4: Why do DNA fragments migrate across the gel...

  • Why must some of your DNA be replicated in fragments? Please do not focus on how...

    Why must some of your DNA be replicated in fragments? Please do not focus on how the DNA is replicated but tell me why some of it must be replicated in fragments.

  • Please I need help on questions 1-4 in great detail please Load 15 mu l of...

    Please I need help on questions 1-4 in great detail please Load 15 mu l of the following samples from the above section onto the simple Wells. Seal the wells with agarose and electrophorese until the bromophenol blue in the samples has migrated to within 2 mm of the positive electrode end of the gel. Remove the gels from the unit and stain them as described in Section IV. Measure the distance of the DNA bands (in cm) from the...

  • 14. Restriction endonucleases are a. enzymes that restrict DNA synthesis b. enzymes that cut DNA in...

    14. Restriction endonucleases are a. enzymes that restrict DNA synthesis b. enzymes that cut DNA in specific sequences c. nuclear proteins that are involved in transcription d. components of the ribosomes involved in protein synthesis 15. The first step in southern blotting is a. converting DNA into RNA b. cutting high molecular weight DNA into smaller pieces c. converting RNA into DNA d. radioactively labeling the DNA so it can be detected after the procedure is complete 16. The major...

  • can you please answer all three questions. Thank you so much!! QUESTION 3: What is the...

    can you please answer all three questions. Thank you so much!! QUESTION 3: What is the purpose of the Tris-Acetate-EDTA (TAE) buffer that the agarose gel is prepared with and submerged in for running? What would happen if you used water to prepare and run the gel instead of TAE buffer? (You should conduct an internet search to answer this question) [2 marks] QUESTION 1: Several factors (including agarose gel concentration, time and current) affect migration of DNA fragments through...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT