Q. 2. The restriction enzymes generally have capability of modification by methylation. By methylation, bacterial DNA will modify and hence bacteria protects its own chromosomal DNA against these restriction enzymes.
Q. 3. The enzymes of E. coli are incubated at around 37 degress celsius as this is the temperature where they perform at optimal level and it is the normal body temperature of humans.
Q. 4. DNA is negatively charged because of the Phosphate groups attached. During gel electrophoresis, electrodes are used to separate DNA particles according to their size and in it the negatively charged DNA particles moves towards the positive electrode that is the anode. Hence, the movement of DNA on gel is due to its negative charge.
Question 2: EcoRI, EcoRII, and EcoRV are all restriction enzymes found in E.coli. How does E.coli...
You are using three restriction enzymes to digest a double-stranded DNA in which the sequence of the upper strand is 5'-TTGTCGATGCGAATTCGGTGATGGATCCTAGGTCGTGTAGCATGCATGCCGGATCCTAGCTGAGC'-3. The recognition sites of the enzymes are G'AATTC (EcoRI), G'GATCC (BamHI), and GCATG'C (SphI). The cleavage sites are indicated with '. Determine how long the DNA fragments will be after digesting the DNA with each of these enzymes individually. Additionally, determine the length of the fragments if you digest with both enzymes BamHI and SphI. In a drawing, show...
Restriction Mapping Below is a restriction map for the plasmid PGEN101 (total length - 20 kb). Using this map as a guide, give the number of restriction fragments along with their associated lengths that would result from digesting PGEN101 with the restriction enzymes EcoRI, BamHII, anda combination of EcoRI + BamHI. BamHI BamHI BamHI / PGEN101 (20 kb) Mb EcoRI Digest Performed Size Emments Obtained EcoRI........ BamHI.. EcoRI + BamHI.... Two freshmen college students, interested in becoming gene jocks, performed...
A. Your lab To see if you understand what you did in our lab, answer the following based in the procedures for the restriction digest and the gel electrophoresis. 1. Using the PGLO map on p7 of the gel electrophoresis procedure, predict the size of the fragments generated by each enzyme EcoRI Hindill, and Pst! (the sizes you would expect to see on the gel.) (6 pts) Hindill -8 fragments were produced by the restriction enzyme. 2. Answer the calculation...
please help me with these questions
Lab 8 Extension Activity: Plasmid Mapping and Restriction Enzymes Mapping the Plasmid The first step in mapping a plasmid is to determine how many times a restriction site is found on that plasmid. Examine the results for plasmid 55 as an example. The data given in the following table are for the double digest using EcoRI and Pstl. Also, giving are the data for single digests by the individual enzymes. The numbers in the...
Chromosomal and plasmid DNA can be cut into manageable pieces by
restriction enzymes. Using agarose gel electrophoresis, the DNA
fragments can be separated on a gel, based on their lengths. In
order to see the fragments, a stain is typically added to the gel.
The size of each fragment can be determined by comparing each one
to a DNA molecular weight marker of known size.
Below is a map of pBR22 plasmid. The position and base pair
number of the...
can
someone explain throughly on how to find a-c??? thanks!!!
The following question will provide practice in interpreting and analyzing gel results. 5. You obtained the DNA electrophoresis gel below. Three samples of lambda phage DNA were digested with 3 different restriction enzymes and the digested DNA was applied to the gel in lane 4 and the bands were visualized. The Hind Ill digest was used as a molecular weight standard marker and produced 6 DNA fragments of known size:...
2) A linear phage chromosome is labelled at both ends with 32P and digested with restriction enzymes. EcoRI produces fragments of sizes 2.9, 4.5. 6.2.7.4, and 8.0 kb. An autoradiogram developed from a Southern blot of this digest shows radioactivity associated with the 6.2 and 8.0 fragments. BamHI cleaves the same molecule into fragments of sizes 6.0, 10.1 and 12.9; the label is found to be associated with the 6.0 and 10.1 fragments. When EcoRI and BamHI are used together,...
Hi I have a problem with number 5, it involves gel
analysis results. There are 2 parts, a,b,c. For A Im sure you need
to make a graph with distance in (cm) on the vertical axis and
log10 bp on the horitzontal. I need help figuring out where to
start and what to do. Please help!
The following question will provide practice in interpreting and analyzing gel results You obtained the DNA electrophoresis gel below. Three samples of lambda phage...
L= No restriction
B=Bam HI
E=EcoRI
H=Hind III
Band 1
27mm
31mm
29mm
29mm
Band 2
NA
34mm
41mm
37mm
Band 3
NA
41mm
46mm
43mm
Band 4
NA
43mm
49mm
52mm
Band 5
NA
46mm
57mm
71mm
Band 6
NA
NA
NA
76mm
Above is the actual measurements for the distance in mm. Please
plug this in with the existing chart located above
Gel Electrophoresis lab assignment The following sheets will be used to demonstrate your knowledge of gel...
please answer question numbe 2.
Restriction endonucleases are bacterial enzymes that recognize, bind, and cut DNA strands at specific recognition sequences. They evolved to protect bacteria from bacterial viruses and are very useful for a wide variety of molecular biology applications. Some of the more common ones include EcoRI which recognizes the 6 bp sequence 5 'GAATTC 3' and cleaves the phosphodiester backbone after the G. Hind III_(AAGCTT), BamHI (G|GATCC), Pstl (CTGCAG), Not! (GC|GGCCGC), Ndel (CATATG) Kpnl (GGTAC^C), Bgl II...