Question

You have cut genomic DNA with AvrII and wish to ligate it into pBluescript. However, there...

You have cut genomic DNA with AvrII and wish to ligate it into pBluescript. However, there is no AvrII site in the multiple cloning region of this plasmid. What other restriction enzyme could you use to cut the plasmid’s multiple cloning region that would produce compatible ends for ligation with your genomic DNA? (Hint: Look up the Compatible Cohesive Ends chart at New England Biolabs website and confer with pBluescript map) (1 point)

0 0
Add a comment Improve this question Transcribed image text
Answer #1

The correct answer is "XbaI​​​​​​".

AvrII has restriction site => 5'- C/CTAGG -3' => that will generate cohesive end of CTAG while XbaI has restriction site => 5'- T/CTAGA-3' that also generates common CTAG end.

Add a comment
Know the answer?
Add Answer to:
You have cut genomic DNA with AvrII and wish to ligate it into pBluescript. However, there...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Suppose you digest the genomic DNA of a particular organism with the restriction enzyme SauA. Then...

    Suppose you digest the genomic DNA of a particular organism with the restriction enzyme SauA. Then you ligate the resulting fragment into a unique BamHI cloning site of a plasmid. The sequence of the restriction sites and position of cleavage is shown below Note: X and Y and their complementary bases Z and Y’ respectively can be any base (A,C, G, or T) 1) As you can see, ligation is possible because the two restriction enzymes produce compatible sticky ends....

  • 3. (2 pts.) You are sequencing the end of a genomic DNA fragment that was cut...

    3. (2 pts.) You are sequencing the end of a genomic DNA fragment that was cut with the restriction enzyme BamH1 and ligated into a plasmid that was also cut with BamH1. You have denatured the DNA and annealed a labeled primer to plasmid sequences adjacent t<o the insertion site as shown below: 3' BamHi 5' GATCTAGCTAGCTAGCTAGCTAGCTAGCTAGCCATCGATGCTAGGAATCTTTGCTGATGCTAGTCGATGCCGTAGC ACTACGATCAGCTACGGC 3' 18 base primer 5' Next you add DNA polymerase, buffer, an excess of all four dNTPs, and a small amount of...

  • 8. Your lab assistant has tried to construct a genomic library of recombinant plasmids using only...

    8. Your lab assistant has tried to construct a genomic library of recombinant plasmids using only the EcoRI restriction enzyme, genomic DNA, a plasmid and DNA ligase. The plasmid used is a typical cloning plasmid with a multiple cloning site (MCS) in the middle of a Lacz gene. After transforming E. coli with the library, a few white colonies are observed but a most of the colonies are blue. Explain what happened and what you would tell your assistant to...

  • 7. You have performed a cloning experiment in which you digested genomic DNA from starfish cells...

    7. You have performed a cloning experiment in which you digested genomic DNA from starfish cells with an enzyme and ligated the fragments into plasmid vectors digested with the same enzyme. The plasmid you are using contains a gene for ampicillin resistance and an MCS located within the Lacz gene. For the ligation, you added three times as much of the digested plasmid as the insert. After introducing the ligated DNA into cells, you observe 200 blue colonies and 33...

  • A restriction map lists the locations of DNA sequences that are cut by a particular restriction...

    A restriction map lists the locations of DNA sequences that are cut by a particular restriction enzyme for a piece of DNA, such as a chromosome or a plasmid. Restriction maps are important when generating a construct for experimental use. Digesting the DNA sequence with the restriction enzymes will result in fragmented DNA of predictable sizes, based on the restriction map, that allow a researcher to analyze if his or her construct was generated correctly when visualized using gel electrophoresis....

  • Can you answer these questions pleasee: If we performed electrophoretic separation (AGE) of human genomic DNA...

    Can you answer these questions pleasee: If we performed electrophoretic separation (AGE) of human genomic DNA (buccal swab extraction), and we didn’t perform any restriction digestion, answer the following: a)In your opinion, which of the loaded samples has the highest and lowest concentration of DNA, respectively? b)Indicate the lanes in which DNA is degraded and explain your answer. c)Take a look into the lane “cut Plasmid”. Explain the appearance of two bands. What kind of a technique was performed on...

  • . Isoschizomers are restriction enzymes that recognize the same sequence, but may not cut in the...

    . Isoschizomers are restriction enzymes that recognize the same sequence, but may not cut in the same position. You want to cut at the site G/GCGCC, but do not have SspDI. What isoschizomer could you use to cut in the same position? (Hint: Use the Enzyme Finder tool at New England Biolabs website) (1 point)

  • 1.When cloning a PCR product into a plasmid using restriction enzymes, the restriction enzyme recognition sequences...

    1.When cloning a PCR product into a plasmid using restriction enzymes, the restriction enzyme recognition sequences in the PCR product most likely came from _______, and the restriction enzyme recognition sequences in the plasmid most likely came from ________. a. A multiple cloning site / the primers b. The primers / a multiple cloning site c. Both came from primers d. Both came from the multiple cloning site e. Naturally present in the gene of interest / the multiple cloning...

  • You are interested in cloning a particular segment of DNA and wish to use a commercial...

    You are interested in cloning a particular segment of DNA and wish to use a commercial cloning vector with a BamHI cloning site. However, your segment of DNA does not contain the appropriate restriction site. Discussing your problem with a colleague they suggest using PCR to address your problem. How can you use a PCR reaction to facilitate a successful cloning?

  • Easy question Given that a DNA fragment law the end (on right): Which one of the...

    Easy question Given that a DNA fragment law the end (on right): Which one of the following DNA ends is com, Place the following steps in chronological order when creating a tomato genomic DNA library. The available materials are DNA ligase, restriction enzyme, tomato leaves, plasmid DNK to act as vector that has already been digested with the restriction enzyme, competent bacteria, and nutrient agar plates containing ampicillin. You may use a step more than once. Add DNA ligase Transform...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT