

pls answer all Question 1: The following figures (Figure 1 and Figure 2) show the structure...
Answer The following Please,
Name: Date: Transcription/Translation Practice Worksheet 1. Use the following DNA strand: TAC GTC ACG AGA TGA GTT ATC ATT A. What is the mRNA synthesized from the DNA strand? B. What is the amino acid sequence that is then translated from this mRNA strand? 2. Use the following DNA stand: TAC TTG GCC ACG GAC TAA CAT GCA A. What is the complementary DNA strand of the above DNA strand? B. Using the complementary DNA strand,...
Please answer this DNA question with details. Thanks
The following is the transcribed strand of DNA: GCG GCG TAC CCC AAA ATA GGG GCG CTC GCG ATT AAA CCG TTC CCC What is the untranscribed strand? What is the mRNA sequence that would be transcribed from the transcribed strand? What is the sequence of tRNA nucleotides that would match up with the mRNA? What is the amino acid sequence that would result from translation of the mRNA?
en the letters write your answer as one word. Do not include the word STOP for the stop codon For Item D: Draw the correct structure for the peptide on Part C. You can write the polypeptide as a condensed structure or as a skeletal structure Given the following single stranded DNA (coding strand answer the following questions 5-AAT ATG TAC GAC AAC GCC TAG AGG 3 a) (Ipt) What is the complementary strand (template strand; 3'-5" direction) for the...
DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in process called DNA curs in the nucleus of s acest FS Parent strand Parent strand Newly replicated DNA Newly replicated DNA- SA0 Daughter DNA molecule Daughter DNA molecule Figure 8.2: Overview of DNA replication and illustration of complementary base pairing. DNA must replicate before cell division so that each new daughter cell receives an exact copy of the parent DNA. 1. Replication begins when...
23. What ensures that the correct amino acid is added during translation? A. the methyl-guanosine cap of a properly modified mRNA B. transcription factors C. the anticodon of a properly formed aminoacyl tRNA D. the sequence of the coding strand E. all of the above 24. If the DNA code for a particular amino acid is 5'AGT3', then the anticodon on the tRNA would be A. 5'TCA3 B. 5'UCA3 C. 5'AGU3 D. 5'ACU3 E. 5'UCA3 25. What enzyme catalyzes the...
4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is underlined. The +1 nucleotide is shown in boldface and red. a. Write the sequence of the mRNA that would be produced by this gene. You may assume that the gene ends at the end of the sequence shown, so you do not need to look for transcription termination signals. You may also assume that it has no introns 5' GCGGTATAACAGGACAGGCTGCATGAGAAGATTCCATCTTCCAGATCACTGTCCTTCTAGCCATGGAAAATGA CGAATTGTGACTGCCCCTGC3' mRNA (make sure...
4. Given the following information: One strand of a section of DNA isolated from E. coli reads 5’-GTAGCCTACCCATAGG-3’ 3’ CATCGGATGGGTACC’5 Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be (please include orientation)? How many different polypeptides chains could potentially be made from this sequence of RNA? Would the same polypeptide chains be made if the other strand of the DNA...
Can anyone explain these answers step by step. Especially I do
not know how to start question 1 or two!!! Thank you!
Work with a partner to complete the following questions. 1. Fill in the bases of the complementary DNA strand. 3-TATAATTACGCTAGATCACCCACT5 2. Transcribe the mRNA sequence using the bottom (3 to 5) strand as the template. What is the name of the sequence upstream of the gene that the RNA polymerase binds to? 3. 4. What polypeptide sequence would...
The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA sequence: TACCAAGGAGCATTAGATACT a.) What is the complementary DNA sequence that would be made if the sequence shown above were used as the template strand during DNA replication? (1 pt) b.) What is the mRNA that would be made from the DNA sequence shown (the sequence given NOT your answer to part a) if it were used as the template strand during transcription? (1 pt)...
14.2 Modeling the Structure and Function of Nucleic Acids and Their Products 2. The following diagram represents some of the puzzle piece pieces used in this section. a Assembled in this form, do they represent an amino acid, c. a portion of messenger RNA, or a deoxyribonucleotide (b) Explain your answer. Opo 3. Why is DNA often called a double helix? 4. State the following ratios. (a) Guanine to cytosine in a double-stranded DNA molecule: (b) Adenine to thymine: -...