![6. Write Ruby recognizer methods limited? and sorted? that expand the Ruby class Array. The expression array.limited? amin,amax) should return true if amin Sali] S amax for all values of i. The expression array.sorted? should return 0 if the array is not sorted 1 if a[0] S a[1]Sa12] S... (increasing sequence) if a a[1] a[2] (decreasing sequence) Show examples of the use of this method.](http://img.homeworklib.com/questions/39fd5f70-f0c9-11eb-a53e-4f8ac4fb197e.png?x-oss-process=image/resize,w_560)
In Ruby, also please take a screenshot of your output and how to run the code.

Copyable
Code:
class Array
#Checks amin <= n and n <= amax for all values in the array
#n for number
def limited?(amin,amax)
self.each do |n|
return false unless amin <= n && n <= amax
end
return true
end
#this is for checks if given array is sorted in increasing or decreasing sequence.
#'n' for number and 'i for index
def sorted?
self.each_with_index do |n, i|
break unless n <= self[i+1] if i != self.length - 1
return "+1" if i == self.length - 1
end
self.each_with_index do |n, i|
break unless n >= self[i+1] if i != self.length - 1
return "-1" if i == self.length - 1
end
return 0
end
end
#display the output for array is increasing sequence
array = [1,2,3,4,5]
puts "array: #{array} - array.limited?(0,10): #{array.limited?(0,10)}, array.sorted?: #{array.sorted?}"
#display the output for array is decreasing sequence
array = [10,7,5,3,1]
puts "array: #{array} - array.limited?(5,11): #{array.limited?(5,11)}, array.sorted?: #{array.sorted?}"
#display the output for array is not sorted
array = [8, 3, 4 ,10, 5]
puts "array: #{array} - array.limited?(0,5): #{array.limited?(0,15)}, array.sorted?: #{array.sorted?}"
In Ruby, also please take a screenshot of your output and how to run the code....
Language C++ (Please include a short description & Screenshot of output) Implement a Priority queue using a SORTED list. Use Quick sort after adding a new node. Example of quick sort below. Adopt to your program the code below. #include <iostream> void quickSort(int a[ ], int first, int last); int pivot(int a[], int first, int last); void swap(int& a, int& b); void swapNoTemp(int& a, int& b); void print(int array[], const int& N); using namespace std; int main() { int test[]...
Please Complete the following C Code with Comments explaining your solution and post a screenshot of it working. Summary: This project explores pattern matching techniques to find a pattern in a DNA sequence containing letters in the DNA alphabet {A, C, G, T}. For example, suppose we have a DNA sequence as follows: ATGACGATCTACGTATGGCAGCCACGCTTTTGATGTTAAGTCACACAGCCAAGTCA ACAAGGGCGACTTCATGATCTTTCCGCTCCGTTGGTGTAGGCCCGTGTTCAAATTC AATGGCTGATTGGAATTACCTTTGAAATACTCCAACCGACCGCCACGGCCAGGGT CCCGCTCGCTCTCTGTGGCCCTCCCACAAAACTCCGGTGAAAGTTGATTTGGACAC GGACCCAAAGCAGCGTAGATTATTCGAGCGTATTCGGTAGTCATTGAGGCCCCAA The pattern “AATGG” can be found at the beginning of the third line. Note that overlapping matches are counted individually. For example,...
PLEASE DO THIS IN RUBY # Write a method bigger_filter that accepts an array of numbers and a target number. The method should return a new array containing the elements that are greater than the given target. def bigger_filter(arr, tar) end print bigger_filter([7,3,2,8,12], 5) # => [7, 8, 12] #puts print bigger_filter([1,2,3], 100) # => [] #puts print bigger_filter([10,9,20,3], 9) # => [10, 20] MY ATTEMPT def bigger_filter(arr, tar) new_arr = [] i = 0 while i...
for the following code I need the source code and output screenshot (includes date/time) in a PDF format. I keep getting an error for the #include "dayType.hpp" dayType.cpp #include"dayType.hpp" string dayType::weekday[7] = {"Sun", "Mon", "Tue", "Wed", "Thur", "Fri", "Sat" }; //set the day void dayType::setDay(string day){ cout << "Set day to: " ; cin >> dayType::day; for(int i=0; i<7; i++) { if(dayType::weekday[i]==dayType::day) { dayType::markDay = i; } } } //print the day void dayType::printDay() { cout << "Day = "...
//CODE 16-02.cpp //Demonstrates a template function that implements //a generic version of the selection sort algorithm. #include <iostream> using std::cout; using std::endl; template<class T> void sort(T a[], int numberUsed); //Precondition: numberUsed <= declared size of the array a. //The array elements a[0] through a[numberUsed - 1] have values. //The assignment and < operator work for values of type T. //Postcondition: The values of a[0] through a[numberUsed - 1] have //been rearranged so that a[0] <= a[1] <=... <= a[numberUsed -...
java : here is a code that I have to implement. counting the occuence in an array /** * _Part 3: Implement this method._ * * Counts the items in the ordered array list that are equal to the item at * the specified index. Be sure to take advantage of the fact that the list * is sorted here. You should not have to run through the entire list to * make this count. * * @param index an...
Please help with a source code for C++ and also need screenshot of output: Step 1: Create a Glasses class using a separate header file and implementation file. Add the following attributes. Color (string data type) Prescription (float data type) Create a default constructor that sets default attributes. Color should be set to unknown because it is not given. Prescription should be set to 0.0 because it is not given. Create a parameterized constructor that sets the attributes to the...
Please solve only if you know how to do it. Write the code using
C++ (not Python or Java). Show and explain everything neatly.
COMMENTS (7.5% of programming assignment grade): Your program should have at least ten (10) different detailed comments explaining the different parts of your program. Each individual comment should be, at a minimum, a sentence explaining a particular part of your code. You should make each comment as detailed as necessary to fully explain your code. You...
SCREENSHOTS ONLY PLEASE!!! DON'T POST ACTUAL
CODE
PLEASE LEAVE A SCREENSHOT ONLY! ACTUAL TEXT IS NOT
NEEDED!!!
mystring.h:
//File: mystring1.h
// ================
// Interface file for user-defined String class.
#ifndef _MYSTRING_H
#define _MYSTRING_H
#include<iostream>
#include <cstring> // for strlen(), etc.
using namespace std;
#define MAX_STR_LENGTH 200
class String {
public:
String();
String(const char s[]); // a conversion constructor
void append(const String &str);
// Relational operators
bool operator ==(const String &str) const;
bool operator !=(const String &str) const;
bool operator >(const...
CODE IN C++ PLEASE INCLUDE A SCREENSHOT OF YOUR CODE Write a program that outputs the shortest distance from a given node to every other node in the graph. Do not change anything in the supplied code below that will be the Ch20_Ex3.cpp except to add documentation and your name. Please use the file names listed below since your file will have the following components: Note: Here are the files that I need graphType.h linkedList.h linkedQueue.h queueADT.h unorderedLinkedList.h weightedGraph.h #include...