I believe the correct answer to be:
Option D) RNA polymerase II, III, I.
As The main difference between RNA Polymerase 1, 2 and 3 is that the RNA polymerase 1 (Pol 1) transcribes rRNA genes and, the RNA polymerase 2 (Pol 2) mainly transcribes mRNA genes while the RNA polymerase 3 (Pol 3) mainly transcribes tRNA genes.
feel free to leave a comment down below for any further query. good rating would be appreciated if you find my answer helpful. thank you.
Part A What is the type of each eukaryotic protein that primarily transcribes mRNA, RNA, and...
Suppose a mutation occurs in the gene encoding eukaryotic RNA polymerase I, II, or lll that renders that polymerase non-functional. Match each RNA polymerase mutation with all of the cellular processes that it would disrupt. Mutation in eukaryotic RNA polymerase I Mutation in eukaryotic RNA polymerase II Mutation in eukaryotic RNA polymerase III pre-mRNA processing RNA synthesispre-mRNA synthesis RNAi-mediated gene regulation IRNA synthesis mRNA translation rRNA processing
Match the following types of RNAs with the main polymerase that transcribes them. Most rRNA genes 5S rRNA genes tRNA genes protein-coding genes miRNA genes Match with a) RNA polymerase I b) RNA polymerase II c) RNA polymerase III
#1 Match the protein to it's function in transcription: RNA polymerase III, Transcription Factor IID, Transcription Factor IIE, Sigma Factor, Transcription Factor IIH, RNA polymerase II, Helicase, RNA polymerase II •Transcribes tRNA •Recognizes promoter region in bacteria •Transcribes mRNA •Recognizes promoter region in eukaryote •Exposes a single stranded DNA template
Part A What are three observations that suggested eukaryotic RNA was an intermediate between DNA and protein? Select the three observations. O DNA plays the major role in replication, which allows for sustainable transfer of genetic information. O RNA is transported out of the nucleus and into the cytoplasm where protein translation occurs. Three types of RNA are found in the cell, and all of them are involved in protein synthesis. O DNA is found in the nucleus and protein...
Prokaryotic mRNA usually encodes for more than one protein while eukaryotic mRNA a single protein. Eukaryotic DNA is linear and bacterial and archaeal DNA is-linear. In prokaryotes, ribosomes attach to the mRNA and start protein synthesis even before transcription is completed. Eukaryotic mRNA, rRNA, and tRNA are all highway processed. Nuclear pore complexes control the entry and exit to and from the nucleus. They will not let mRNA exit the nucleus before it is full processed. Eukaryotic and archaeal DNA...
- Part A Match the folowing statements with rRNA, mRNA, or tRNA Reset Help acts as a terrplate for protein synthesis combines with proteins to form ribasomes brings amino acids to the nbosomes for protein synthesis RNA MRNA RNA Submit Provide Feedback
A Which of the following statements about Electromobility Shift Assays (EMSA) is correct? 1 EMSA gels contain SDS detergent to maintain the shape of the of protein. 2 Large DNA molecules flow faster down the gel towards the positive pole in EMSA. 3 EMSA gels cannot be used to determine whether a particular protein has bound to a specific DNA sequence. 4 Smaller DNA molecules flow faster down the gel towards the positive pole in EMSA. B Which of the...
Part A Outline the roles of
double-stranded RNA (dsRNA) in eukaryotic gene regulation. Select
all that apply.
Part A Outline the roles of double-stranded RNA (dsRNA) in eukaryotic gene regulation Select all that apply. O dsRNA can inhibit gene expression by inhibition of transcription through heterochromatin formation. O dsRNA can inhibit gene expression by inhibition of transcription through inhibitor synthesis. O dsRNA can inhibit gene expression by destruction of mRNA. O dsRNA can inhibit gene expression by inhibition of replication....
5. The sequence of a complete eukaryotic gene encoding the small protein Met Tyr Arg Gly Ala is shown here. All of the written sequences on the template strand are transcribed into RNA. 5' CCCCTATGCCCCCCTGGGGGAGGATCAAAACACTTACCTGTACATGGC 3' 3' GGGGATACGGGGGGACCCCCTCCTAGTTTTGTGAATGGACATGTACCC 5' a. Which strand is the template strand? [2 pts] b. Which direction (right-to-left or left-to-right) does RNA polymerase move along the template as it transcribes this gene? [2 pts] c. What is the sequence of the nucleotides in the processed (mature)...
choose the right answer : 1- what is degradation of ' unwanted' proteins in eukaryotic cells A- polyribosomes B- proteasomes C- editosome D- spliceosomes 2- addition or deletion of bases causes which kind of mutation A- transition B- transcription C- transversion D- frameshift mutation 3- point mutation involve : A- change in single base pair B- deletion C- duplication D- insertion 4- what is the complementary m-RNA sequence for the DNA sequence C-A-A-G-G-T A- C-A-A-G-G-U B- G-U-U-C-C-A C- C-A-A-G-G-T D-...