Question

The data below were obtained as the result of the Sanger method of DNA sequencing. Determine the DNA sequence. making sure to indicate 5 and 3 ends, and add the sequence for the complementary strand
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Ans-read the sequence from small fragments to larger fragments from 5' ends to 3' ends.

5'- AAGCGGTAAGCTTTTGCCCGCGTAGA-3'

3'- TTCGCCATTCGAAAACGGGCGCATCT-5'

Add a comment
Know the answer?
Add Answer to:
The data below were obtained as the result of the Sanger method of DNA sequencing. Determine...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • ddATP ddCTP ddGTP ddTTP The autoradiogram shown was obtained from a DNA sequencing method called Sanger...

    ddATP ddCTP ddGTP ddTTP The autoradiogram shown was obtained from a DNA sequencing method called Sanger sequencing or dideoxy sequencing. The arrow shows the direction of migration of the DNA samples during electrophoresis. Determine the sequence of the DNA template strand, in the 5' to 3' direction, from this data. 5' – CGTCAATTTAG

  • 9. (8 points) Use the figure below to answer the following questions about Sanger Dideoxy sequencing....

    9. (8 points) Use the figure below to answer the following questions about Sanger Dideoxy sequencing. GATC 11.1 This figure represents a portion of a polyacrylamide gel used to separate DNA fragments produced from a Sanger dideoxy DNA sequencing reaction. Write the sequence of the boxed portion of the newly synthesized (nascent) strand (in the 5' to 3' direction). Label the 5' and 3' ends of the DNA sequence. 11 il Write the DNA sequence of the complementary template strand...

  • QUESTION 31 The gel below shows the result of sequencing a piece of DNA (the "template")....

    QUESTION 31 The gel below shows the result of sequencing a piece of DNA (the "template"). Each lane shows the fragments of the new strand (the "daughter" strand) that are produced when a given ddNTP is added to the PCR reaction. Based on these results, what is the sequence of the template (original) DNA strand? Please write (type) it out, making sure you indicate the 5' and 3" ends ddATP ddTTP ddCTP ddGTP well well well well save Click Save...

  • Which of the following make(s) sequencing by the Sanger chain-termination method possible? (Selec...

    Which of the following make(s) sequencing by the Sanger chain-termination method possible? (Select all that apply.)12.17 a. Complementary single-stranded nucleic acid sequences can come together to form a duplex molecule. b. Single-stranded nucleic acid molecules can be immobilized on certain types of filter paper. c. A DNA strand whose 3' end terminates in a dideoxynucleotide cannot be elongated. d. Duplex nucleic acid molecules can be separated by size by means of electrophoresis. e. New nucleotides are added only to the...

  • please help with all three! For DNA synthesis to take place in a Sanger sequencing reaction,...

    please help with all three! For DNA synthesis to take place in a Sanger sequencing reaction, the DNA polymerase must catalyze a reaction between the 3'- the last nucleotide and the 5- of the next nucleotide to be added. hydroxyl group, phosphate group O phosphate group, hydroxyl group O hydroxyl group, hydroxyl group O phosphate group, phosphate group QUESTION 6 millions of individual DNA fragments are isolated and sequenced in parallel during each machine run. O traditional whole-genome sequencing O...

  • What is the sequence of the template DNA used to make this Sanger (chain termination) sequencing...

    What is the sequence of the template DNA used to make this Sanger (chain termination) sequencing gel? A C GT a.5' - TTGGCCAAA - 3 6.5' - AAACCGGTT-3' OC. 5'- ATGGACTCA - 3 d. 5'-ACTCAGGTA - 3' e. 5' - TGAGTCCAT - 3'

  • 3. A primer used in dideoxy DNA sequencing is 5’GGATCCATGACTAGTCCGAC-3’. A segment of DNA is cloned...

    3. A primer used in dideoxy DNA sequencing is 5’GGATCCATGACTAGTCCGAC-3’. A segment of DNA is cloned into a vector and then the vector DNA is denatured and subjected to dideoxy DNA sequencing method. Below is the DNA sequence from a region of the vector. 5’GGGCTAGCCGGATCCATGACTAGTCCGACTTACTGACCATCGACTCATCC-3’ 3-CCCGATCGGCCTAGGTACTGATCAGGCTGAATGACTGGTAGCTGAGTAGG-5’ To which DNA strand does the primer bind, the top or bottom one? Based on the sequence above, what would be the sizes of the bands (i.e., the number of nucleotides in each band)...

  • Attempt 3 - Question 13 of 22 > ddATP ddCTP ddGTP ddTTP The autoradiogram shown was...

    Attempt 3 - Question 13 of 22 > ddATP ddCTP ddGTP ddTTP The autoradiogram shown was obtained from a DNA sequencing method called Sanger sequencing or dideoxy sequencing. The arrow shows the direction of migration of the DNA samples during electrophoresis. Determine the sequence of the DNA template strand, in the 5' to 3' direction, from this data. 5-

  • The following diagram represents a replication bubble associated with DNA synthesis. Based on this diagram, select...

    The following diagram represents a replication bubble associated with DNA synthesis. Based on this diagram, select all of the options below that are true. 1 | 2 ---- Quadrants 1 and 4 are associated with lagging strand synthesis Quadrants 1 and 4 are associated with leading strand synthesis Quadrants 1 and 2 are associated with lagging strand synthesis Quadrants 3 and 4 are associated with lagging strand synthesis Synthesis of both daughter strands is completely continuous Telomerase activity is needed...

  • 1. Compare and contrast first generation sequencing techniques (Sanger sequencing and pyrosequencing) and the second generation...

    1. Compare and contrast first generation sequencing techniques (Sanger sequencing and pyrosequencing) and the second generation sequencing technique ForenSeq using the MiSeq. Include a discussion of reagents, time, cost, optimal sequence length, detection technologies, data output and post-testing analysis in your discussion. Tabulate your answers and be sure to complete the table. 2. Describe the processes that are occurring in PCR1 and PCR2. Why are each of these steps important. Describe the roles of i5 and i7, forward and reverse...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT