Question

In high-throughput sequencing, the primers bind to a) oligonucleotides attached to the fragments. b) free dNTPs....

In high-throughput sequencing, the primers bind to

a) oligonucleotides attached to the fragments.

b) free dNTPs.

c) DNA polymerase.

d) the sequence fragments themselves.

e) nothing.

0 0
Add a comment Improve this question Transcribed image text
Request Professional Answer

Request Answer!

We need at least 10 more requests to produce the answer.

0 / 10 have requested this problem solution

The more requests, the faster the answer.

Request! (Login Required)


All students who have requested the answer will be notified once they are available.
Know the answer?
Add Answer to:
In high-throughput sequencing, the primers bind to a) oligonucleotides attached to the fragments. b) free dNTPs....
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Similar Homework Help Questions
  • In order to sequence a strand of DNA, all four dNTPs, ddGTP, DNA polymerase and primers...

    In order to sequence a strand of DNA, all four dNTPs, ddGTP, DNA polymerase and primers (5’ ACTGA 3’) are added to a test tube. A template strand of DNA is shown below. How many fragments of different lengths would you have at the end of the sequencing process? (write down the sequence of each fragment and the length of the fragment for full credit) DNA Sequence 3’ TGACTCTAGCCTAGGACTATATCG 5’

  • 7) Most types of high-throughput DNA sequencing use: A) reverse transcriptase B) DNA polymerase C) luciferase...

    7) Most types of high-throughput DNA sequencing use: A) reverse transcriptase B) DNA polymerase C) luciferase D) restriction enzymes

  • PCR utilizes specific DNA primers and polymerase enzyme to make copies of particular DNA sequence. The...

    PCR utilizes specific DNA primers and polymerase enzyme to make copies of particular DNA sequence. The primers must attach to separated DNA at the target sequences so that the polymerase can build new DNA strands. What must also be added to the mixture besides primers and polymerase enzyme in order to get amplification and DNA? a. RNA polymerase b. dNTPs c. electron carriers d. DNA repair enzymes

  • Even though you are sending your plasmid to Eton Bio for sequencing, if you were setting...

    Even though you are sending your plasmid to Eton Bio for sequencing, if you were setting up a Sanger sequencing reaction, each reaction should include template DNA, nucleotides (dNTPs), dideoxynucleotides (ddNTPs), reaction buffer, DNA polymerase, and _____. (A) Forward and reverse primers (B) Forward or reverse primers (C) Forward and reverse probes (D) Forward or reverse probes

  • please answer this question with a correct and concise explanation, thank you so much! 1 QUESTION...

    please answer this question with a correct and concise explanation, thank you so much! 1 QUESTION 6 What is the difference in the contents of a PCR reaction vs a sequencing reactions? a. Presence of DNA polymerase vs RNA polymerase b. Primers C. ddNTPs d. Template DNA e. dNTPs

  • Which of the following answer(s) are true (select all that apply)? a)PCR results in exclusively the...

    Which of the following answer(s) are true (select all that apply)? a)PCR results in exclusively the desired region to be amplified. b) PCR primers must be outside the region of interest. c) PCR primers must be flanking the region of interest. d) Sequencing primers must be flanking the region of interest. e) All of the nucleotides used in Sanger Sequencing would also be able to be used for a PCR reaction where you are trying to amplify a gene of...

  • The observation that in any DNA sample, A T and G C A. DNase sequencing An...

    The observation that in any DNA sample, A T and G C A. DNase sequencing An analytical method that determines which segments of DNA are bound by a particular B. Chargaff's rule protein factor, such as a transcription factor C. ChIP sequencing D. Euchromatin E. Histone acetylation F. major groove - # Areas associated with a eukaryotic gene that are where most DNA methylation occurs. # An analytical technique that involves a small slide or chip with many segments of...

  • In DNA sequencing, ddNTPs differ from dNTPs in that ddNTPs are lacking a OH at the...

    In DNA sequencing, ddNTPs differ from dNTPs in that ddNTPs are lacking a OH at the a. 2' carbon b. 5' carbon c. 3' carbon please answer as many as you can!! I am low on questions and could use the help! Mother || Child II Male 1 Male 2 Results from a paternity test using DNA fingerprinting is shown. DNA was isolated from a mother, her child and 2 potential fathers. Primers designed to amplify different satellite DNA regions...

  • All cells in a mouse are genetically identical, yet many cells like brain or liver cells...

    All cells in a mouse are genetically identical, yet many cells like brain or liver cells perform specialized functions. How do these cells achieve this level of specialization? a. Through transcription factor activity b. Through alternative splicing of mRNA c. Through the accumulation of mutations d. Through gene silencing e. Through post-translational modifications Which material would not be required for determining the sequence of a 400 bp DNA fragment by the high-throughput sequencing method? a. A short, artificially synthesized primer...

  • Read the following abstract: "The advent of high-throughput sequencing led to breakthroughs in microbiome analysis and...

    Read the following abstract: "The advent of high-throughput sequencing led to breakthroughs in microbiome analysis and to an explosion of bacterial genomes being released in public repositories. However, many microbiotas cannot be cultured in the lab without introducing drastic changes in the underlying bacterial communities and the distribution of genomes present in online repositories is heavily skewed towards organisms that are amenable to culturing. Those that cannot (or should not in the case of dangerous pathogens) be cultured are often...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT