Homework Answers
DNA is the structure which is made up of multiple nucleotides(a nitrogenous base, sugar and a Phosphate group) which are connected by hydrogen bonds.
The nitrogen bases are Adenine, Guanine, Cytosine, Thymine and Uracil is seen in RNA instead of Thymine.
The sugar are two: Deoxyribose sugar in case of DNA and Ribose sugar in case of RNA.
The Phosphate groups are connected to the sugar molecules.
The above structure is DNA consisting of one Purine (Adenine) and one Pyrimidine (Thymine), two Deoxyribose sugars connected to them and Phosphate groups are connected to sugar molecules.
a. So, the above structure can be confirmed as DNA as it is having Deoxyribose sugars and Thymine nitrogen base.
b. The two bases shown above are 1. Adenine 2. Thymine.
c. Below is the complementary strand and hydrogen bonding and sugar Phosphate backbone is shown.
If you like my answer please
give me thumbs up.
Unwinds DNA strand to make replication fork. Adds free nucleotides to the growing daughter DNA strands...
Unwinds DNA strand to make replication fork. Adds free nucleotides to the growing daughter DNA strands Adds short pieces of RNA to help DNA polymerase start Removes RNA and replaces with DNA Fuses or "glues" fragments of DNA together Proofreads or edits the DNA, checking for mistakes Given the following, DNA Sequence, what is the new daughter strand? (Did you label the 5' and 3' ends?) What is the name of the "fragments" of DNA on the lagging strand after...
Below is a diagram of a section of a DNA molecule. Answer the question based on...
Below is a diagram of a section of a DNA molecule. Answer the
question based on the diagram. Here are the answers for
questions.
3' end of strand
5' end of strand
deoxyribose sugar
ribose sugar
hydrogen bonds between nitrogenous bases
phosphodiester bond containing phosphate group
purine bases
pyrimidine bases.
A indicates -
B indicates -
C indicates -
D indicates -
E indicates -
G indicates -
H indicates -
сн. о. он,С, А1 т он,с.
You can tell that this is an image of a DNA nucleotide and not an RNA...
You can tell that this is an image of a DNA nucleotide and not an RNA nucleotide because you see a O PO 0I double-stranded molecule, not a single-stranded molecule O uracil nitrogenous base, not a thymine nitrogenous base O O sugar with two, and not three, oxygen atoms thymine nitrogenous base, not a uracil nitrogenous base phosphate group, not a uracil O O Submit Request Answer
Each of the following statements about the structure of DNA may be either true or false....
Each of the following statements about the structure of DNA may be either true or false. Choose the appropriate answer for each of these statements. Bonding between adenine and thymine on opposite strands involves two hydrogen bonds. Nitrogenous bases are located on the outside of the double helix: phosphates are located towards the middle of the double helix. Bonding between guanine and cytosine on opposite strands involves three hydrogen bonds. DNA and RNA are structurally different due to the difference...
2. The sequence below represents two DNA strands linked together by hydrogen bonds. The smaller DNA...
2. The sequence below represents two DNA strands linked together by hydrogen bonds. The smaller DNA strand has a 3'-OH that will be used by the DNA polymerase to add nucleotides using the longer DNA strand as a template. You add dATP, SCTP, dTTP, and ddGTP (dideoxy-GTP); and incubate at the DNA polymerase optimum temperature to allow the extension of the smaller DNA strand. Using the symbols below, draw the extended DNA strand (you don't need to draw the template...
Draw the chemical structure of the DNA trimer 5’-ACG-3’ hydrogen-bonded to its complementary strand. Include the...
Draw the chemical structure of the DNA trimer 5’-ACG-3’ hydrogen-bonded to its complementary strand. Include the deoxyribose rings and the phosphodiester backbones and show the H-bonding interactions between the bases.
You are told that in the DNA sequence below the bottom strand is the coding strand....
You are told that in the DNA sequence below the bottom strand is the coding strand. 5' - CCTAAGGGTTAA - 3' 3' - GGATTCCCAATT - 5' If this sequence were to be transcribed, what would the sequence of the messenger RNA be? 5' - UUAACCCUUAGG - 3' This is the answer, can someone explain how you get this answer.
1. DNA Replication (10 Pts.) Create your own strand of dsDNA being sure to indicate 3’...
1. DNA Replication (10 Pts.) Create your own strand of dsDNA being sure to indicate 3’ and 5’ ends. Tell me how DNA is replicated including how bases pair. Show me DNA replication using your strand (this can be hand drawn). What enzymes are used to actually make the new DNA? How is the DNA primed for replication? What enzyme is responsible for this? What enzyme removes the primer and fills in the gap with DNA? What enzyme covalently bonds...
DNA Worksheet DNA by the numbers : Write the correct number in each blank ( when...
DNA
Worksheet
DNA
by the numbers : Write the correct number in each blank ( when
necessary, assume we are talking about B DNA).
________ DNA strands in a double helix
________ hydrogen bonds in an A-T base pair
________ hydrogen bonds in a G-C base pair
_______nucleotides in one turn of a double helix
____nm between two bases on a strand of DNA
________ nm in one turn of a double helix
________ nm in diameter
________ the end...
The strand below is a piece of DNA coding strand 5' - ACTCCGGGTGAGGTATCAAT - 3' Its...
The strand below is a piece of DNA coding strand 5' - ACTCCGGGTGAGGTATCAAT - 3' Its reading frame is set and it can be seen in the middle of the gene sequence. Write out its mRNA strand sequence.
Unwinds DNA strand to make replication fork. Adds free nucleotides to the growing daughter DNA strands Adds short pieces of RNA to help DNA polymerase start Removes RNA and replaces with DNA Fuses or "glues" fragments of DNA together Proofreads or edits the DNA, checking for mistakes Given the following, DNA Sequence, what is the new daughter strand? (Did you label the 5' and 3' ends?) What is the name of the "fragments" of DNA on the lagging strand after...
Below is a diagram of a section of a DNA molecule. Answer the
question based on the diagram. Here are the answers for
questions.
3' end of strand
5' end of strand
deoxyribose sugar
ribose sugar
hydrogen bonds between nitrogenous bases
phosphodiester bond containing phosphate group
purine bases
pyrimidine bases.
A indicates -
B indicates -
C indicates -
D indicates -
E indicates -
G indicates -
H indicates -
сн. о. он,С, А1 т он,с.
You can tell that this is an image of a DNA nucleotide and not an RNA nucleotide because you see a O PO 0I double-stranded molecule, not a single-stranded molecule O uracil nitrogenous base, not a thymine nitrogenous base O O sugar with two, and not three, oxygen atoms thymine nitrogenous base, not a uracil nitrogenous base phosphate group, not a uracil O O Submit Request Answer
Each of the following statements about the structure of DNA may be either true or false. Choose the appropriate answer for each of these statements. Bonding between adenine and thymine on opposite strands involves two hydrogen bonds. Nitrogenous bases are located on the outside of the double helix: phosphates are located towards the middle of the double helix. Bonding between guanine and cytosine on opposite strands involves three hydrogen bonds. DNA and RNA are structurally different due to the difference...
2. The sequence below represents two DNA strands linked together by hydrogen bonds. The smaller DNA strand has a 3'-OH that will be used by the DNA polymerase to add nucleotides using the longer DNA strand as a template. You add dATP, SCTP, dTTP, and ddGTP (dideoxy-GTP); and incubate at the DNA polymerase optimum temperature to allow the extension of the smaller DNA strand. Using the symbols below, draw the extended DNA strand (you don't need to draw the template...
DNA
Worksheet
DNA
by the numbers : Write the correct number in each blank ( when
necessary, assume we are talking about B DNA).
________ DNA strands in a double helix
________ hydrogen bonds in an A-T base pair
________ hydrogen bonds in a G-C base pair
_______nucleotides in one turn of a double helix
____nm between two bases on a strand of DNA
________ nm in one turn of a double helix
________ nm in diameter
________ the end...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 11 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 11 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 11 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 11 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 11 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 11 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 11 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 11 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 11 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 11 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 11 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 11 months ago