Question

You are told that in the DNA sequence below the bottom strand is the coding strand....

You are told that in the DNA sequence below the bottom strand is the coding strand.
5' - CCTAAGGGTTAA - 3'
3' - GGATTCCCAATT - 5'
If this sequence were to be transcribed, what would the sequence of the messenger RNA be?

5' - UUAACCCUUAGG - 3'

This is the answer, can someone explain how you get this answer.

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Transcription is the first step in gene expression. It involves copying a gene's DNA sequence to make an RNA molecule. Transcription is performed by enzymes called RNA polymerases, which link nucleotides to form an RNA strand (using a DNA strand as a template).

The goal of transcription is to make a RNA copy of a gene's DNA sequence. For a protein-coding gene, the RNA copy, or transcript, carries the information needed to build a polypeptide (protein or protein subunit). Eukaryotic transcripts need to go through some processing steps before translation into proteins

Transcription of a gene takes place in three stages: initiation, elongation, and termination.

  1. Initiation: RNA polymerase binds to a sequence of DNA called the promoter, found near the beginning of a gene. Each gene (or group of co-transcribed genes, in bacteria) has its own promoter. Once bound, RNA polymerase separates the DNA strands, providing the single-stranded template needed for transcription.

  1. Elongation: One strand of DNA, the template strand, acts as a template for RNA polymerase. As it "reads" this template one base at a time, the polymerase builds an RNA molecule out of complementary nucleotides, making a chain that grows from 5' to 3'. The RNA transcript carries the same information as the non-template (coding) strand of DNA, but it contains the base uracil (U) instead of thymine (T).

  1. Termination: Sequences called terminators signal that the RNA transcript is complete. Once they are transcribed, they cause the transcript to be released from the RNA polymerase. An example of a termination mechanism involving formation of a hairpin in the RNA is shown above.
Add a comment
Know the answer?
Add Answer to:
You are told that in the DNA sequence below the bottom strand is the coding strand....
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • You are told that in the DNA sequence below the bottom strand is the coding strand....

    You are told that in the DNA sequence below the bottom strand is the coding strand. 5' - ATGTTTAGCGCC - 3' 3' - TACAAATCGCGG - 5' If this sequence were to be transcribed, what would the sequence of the messenger RNA be? a 3' - GGCGCUAAACAU - 5' b 5' - CCGCGAUUUCUA - 3' c 3' - CCGCGAUUUCUA - 5' d 5' - GGCGCUAAACAU - 3'

  • If a gene had the DNA sequence 5-GCTTGA-3' in the nontemplate (sense) strand of its RNA-coding...

    If a gene had the DNA sequence 5-GCTTGA-3' in the nontemplate (sense) strand of its RNA-coding region, what sequence would end up in the RNA when this gene is transcribed? Select one: a. 5'-CGAACU-3' b. 5'-AGUUCG-3' c. 5'-GCUUGA-3' d. 5'-UCAAGC-3' X

  • A portion of DNA sequence is    5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top)    3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom)...

    A portion of DNA sequence is    5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top)    3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) Assume GTACCGATCAGCAGTCA and CATGGCTAGTCGTCAGT are introns 1) Which strand will be the template strand for the transcription? 2) Write down the mature messenger RNA sequence, label the 5' and 3' ends, and additional elements found in mature messenger RNA. 3) Based on the mRNA sequence, draw a line between each codon in question 2) and write the sequence for the polypeptide that can be...

  • The following is a fragment of double stranded DNA . The bottom strand is the template...

    The following is a fragment of double stranded DNA . The bottom strand is the template strand. It encodes a hypothetical 6 amino protein & includes the start (initiator) codon, a small amount of 5’ UTR, and a small amount of 3’ UTR TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA (Template strand) The bottom strand is the template strand and the RNA polymerase will always move from right-to-left, this is the direction of RNA synthesis RNA transcript compares to the non-template strand by being exactly...

  • 4. Imagine the following DNA sequence is a real sequence of a gene (coding strand). This...

    4. Imagine the following DNA sequence is a real sequence of a gene (coding strand). This gene has only one exon meaning no sequence is spliced out during RNA processing. a) What will be the amino acid sequence this gene codes for? 15 points will be given for a completely correct amino acid sequence. You can get partial points if: the beginning of the amino acid sequence is correct (at least two first amino acids, 4 points), and/or the end...

  • Original DNA sequence (coding strand), starting at the beginning of the gene: Normal: 5'-ATGATCTCCTAATACAA... Mutation: 5'-TTGATCTCCTAATACAA......

    Original DNA sequence (coding strand), starting at the beginning of the gene: Normal: 5'-ATGATCTCCTAATACAA... Mutation: 5'-TTGATCTCCTAATACAA... 30. Can a single nucleotide be a conserved sequence? Explain your answer. (4 Points) 31. Explain why self-splicing introns support the RNA world first Hypothesis (life evolved via RNA). (3 Points)

  • DNA sequence of a one strand of a gene to be transcribed is: 3’ — AGTCCGATGGGCT...

    DNA sequence of a one strand of a gene to be transcribed is: 3’ — AGTCCGATGGGCT GA — 5’ the sequence of the MRNA is: 3’ — AGUCCGAUGGGCTGA — 5’ the sequence of the DNA strand shown above is that of the: a. template strand b. coding strand

  • Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains...

    Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains a start codon and could serve as the template for synthesis of an mRNA molecule. 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) a. Which strand will serve as the template strand for transcription? b. Based on the template strand you have chosen, write the mature mRNA sequence on your answer sheet in the 5’ to 3’ direction. Be sure to label 5’ and...

  • Original DNA sequence (coding strand), starting at the beginning of the gener Normal: 5-ATGATCTCCTAATACAA... Mutation: 5'-TTGATCTCCTAATACAA......

    Original DNA sequence (coding strand), starting at the beginning of the gener Normal: 5-ATGATCTCCTAATACAA... Mutation: 5'-TTGATCTCCTAATACAA... 30. Can a single nucleotide be a conserved sequence? Explain your answer. (4 points) 31. Explain why self-splicing introns support the RNA world first Hypothesis (life evolved via RNA). (3 Points) 32. How can the speed of DNA replication increase, while the rate of replication remains constant7 For example, if each chromosome in the human genome initiates DNA replication, at a rate of 50...

  • Answer please? The sequence below represents a middle section of the template strand of DNA of...

    Answer please? The sequence below represents a middle section of the template strand of DNA of a structural gene in an eukaryote organism. Please fill in the blanks that correspond. The consensus sequences that the spliceosome recognizes are marked in red. The intron(s) are marked in lowercase. YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written. DNA: 3 CATGGACAGgtaagaatacaacacagGTCGGCATGACG 5' What would be the immature RNA...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT