You are told that in the DNA sequence below the bottom strand is the coding strand.
5' - ATGTTTAGCGCC - 3'
3' - TACAAATCGCGG - 5'
If this sequence were to be transcribed, what would the sequence of
the messenger RNA be?
| a |
3' - GGCGCUAAACAU - 5' |
|
| b |
5' - CCGCGAUUUCUA - 3' |
|
| c |
3' - CCGCGAUUUCUA - 5' |
|
| d |
5' - GGCGCUAAACAU - 3' |
Answer
Option D is correct i.e " 5' - GGCGCUAAACAU - 3' ".
Explanation
As in the question, it is mentioned that the bottom strand is the coding strand which is identical to the mRNA synthesized but in mRNA T is replaced with U.
mRNA is always complementary to Template strand but identical to Coding strand.
You are told that in the DNA sequence below the bottom strand is the coding strand....
You are told that in the DNA sequence below the bottom strand is the coding strand. 5' - CCTAAGGGTTAA - 3' 3' - GGATTCCCAATT - 5' If this sequence were to be transcribed, what would the sequence of the messenger RNA be? 5' - UUAACCCUUAGG - 3' This is the answer, can someone explain how you get this answer.
If a gene had the DNA sequence 5-GCTTGA-3' in the nontemplate (sense) strand of its RNA-coding region, what sequence would end up in the RNA when this gene is transcribed? Select one: a. 5'-CGAACU-3' b. 5'-AGUUCG-3' c. 5'-GCUUGA-3' d. 5'-UCAAGC-3' X
The following is a fragment of double stranded DNA . The bottom strand is the template strand. It encodes a hypothetical 6 amino protein & includes the start (initiator) codon, a small amount of 5’ UTR, and a small amount of 3’ UTR TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA (Template strand) The bottom strand is the template strand and the RNA polymerase will always move from right-to-left, this is the direction of RNA synthesis RNA transcript compares to the non-template strand by being exactly...
A portion of DNA sequence is 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) Assume GTACCGATCAGCAGTCA and CATGGCTAGTCGTCAGT are introns 1) Which strand will be the template strand for the transcription? 2) Write down the mature messenger RNA sequence, label the 5' and 3' ends, and additional elements found in mature messenger RNA. 3) Based on the mRNA sequence, draw a line between each codon in question 2) and write the sequence for the polypeptide that can be...
DNA sequence of a one strand of a gene to be transcribed is: 3’ — AGTCCGATGGGCT GA — 5’ the sequence of the MRNA is: 3’ — AGUCCGAUGGGCTGA — 5’ the sequence of the DNA strand shown above is that of the: a. template strand b. coding strand
Here is a strand of mRNA: 5’-AAUCAUGUCCGAGGGCUACCCGUAG-3’ Write the sequence of the template strand of DNA that gave rise to this messenger RNA.
Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains a start codon and could serve as the template for synthesis of an mRNA molecule. 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) a. Which strand will serve as the template strand for transcription? b. Based on the template strand you have chosen, write the mature mRNA sequence on your answer sheet in the 5’ to 3’ direction. Be sure to label 5’ and...
Question 4 1 pts What will be the RNA sequence that is transcribed from the DNA sequence below? 5' - TTACCGCTA - 3' (TEMPLATE STRAND) 3' - AATGGCGAT - 5' (CODING STRAND) 5'|TTACCGCTA | 3 5'TUAGCGGUAA3 5'UUACCGCUA13' 5'| TAGCGGTAA3
The sequence below represents a middle section of the template strand of DNA of a structural gene in an eukaryote organism. Please fill in the blanks that correspond. The consensus sequences that the spliceosome recognizes are marked in red. The intron(s) are marked in lowercase. YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written. DNA: 3'CATGGACAGgtaagaatacaacacagGTCGGCATGACG 5 GUACCUGUCcauucuuauguugugucCAGCCGUACUGC What would be the immatur RNA sequence transcribed...
Shown below is the sequence of a coding strand of DNA that begins with what corresponds to the translation start codon (AUG) in the mRNA transcript. You are analyzing two different mutants. Mutant #1 has an extra C residue after the underlined G residue and Mutant 2 has a deletion of the underlined A residue. Wild type 5’- ATGCTTACTGAGGTCATGGTACAGATGA Mutant 1 5’- ATGCTTACTGCAGGTCATGGTACAGATGA Mutant 2 5’- ATGCTTACTGAGGTCATGGTCAGATGA What is the amino acid sequence of the polypeptide encoded by: B. The...