Question

Question 4 1 pts What will be the RNA sequence that is transcribed from the DNA sequence below? 5 - TTACCGCTA - 3 (TEMPLATE
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Answer- 5'-UAGCGGUAA-3'

Transcription is one of the step which takes place in the process of gene expression, during which the DNA sequences are copied to RNA sequence by RNA polymerase and the resultant mRNA sequence is complementary to template sequence or similar to coding sequence( except T is replaced by U).

Add a comment
Know the answer?
Add Answer to:
Question 4 1 pts What will be the RNA sequence that is transcribed from the DNA...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • DNA sequence of a one strand of a gene to be transcribed is: 3’ — AGTCCGATGGGCT...

    DNA sequence of a one strand of a gene to be transcribed is: 3’ — AGTCCGATGGGCT GA — 5’ the sequence of the MRNA is: 3’ — AGUCCGAUGGGCTGA — 5’ the sequence of the DNA strand shown above is that of the: a. template strand b. coding strand

  • 1.) In which direction is RNA transcribed?    2.) Which of the two strands (A or...

    1.) In which direction is RNA transcribed?    2.) Which of the two strands (A or B) serves as the TEMPLATE strand for the transcription of a mRNA that contains both a start and a stop codon?    3.) Which number (1, 2, 3, 4, or 5) best approximates the location of the -10 consensus sequence?    4.) How many amino acids long is the protein encoded by the mRNA from this DNA sequence?    5.) What is the second...

  • Question 2 1 pts A sequence of DNA that contains information for the synthesis of RNA...

    Question 2 1 pts A sequence of DNA that contains information for the synthesis of RNA molecules used in the manufacture of proteins is also known as a(n) intron. mutation. gene. codon. Flag this Question Question 3 1 pts A small segment of DNA on the template strand contains the base sequence CGT. If an mRNA transcript is made that includes this sequence, what would be the anticodon on the tRNA that would bind to this corresponding mRNA sequence? CGT...

  • Question 2 1 pts What happens at the telomere once the RNA primer is removed? Think...

    Question 2 1 pts What happens at the telomere once the RNA primer is removed? Think carefully about this answer! The question in my presentation had a mistake. DNA poll replaces the RNA primer at the 5' end of the new strand with DNA. DNA poll replaces the RNA primer at the 3' end of the new strand with DNA. None of the above Question 4 1 pts Telomerase works by Elongating the 5' to 3' newly replicated DNA strand...

  • 5) The following sequence of nucleotides is found in a single-stranded DNA template: (3 pts)            ...

    5) The following sequence of nucleotides is found in a single-stranded DNA template: (3 pts)             ATTGCCAGATCATCCCAATAGAT Label the 5’ and 3’ ends of the DNA template. (1 pt) b) Give the sequence and label the 5’ and 3’ ends of the RNA transcribed from this template. (2 pts)

  • If a gene had the DNA sequence 5-GCTTGA-3' in the nontemplate (sense) strand of its RNA-coding...

    If a gene had the DNA sequence 5-GCTTGA-3' in the nontemplate (sense) strand of its RNA-coding region, what sequence would end up in the RNA when this gene is transcribed? Select one: a. 5'-CGAACU-3' b. 5'-AGUUCG-3' c. 5'-GCUUGA-3' d. 5'-UCAAGC-3' X

  • This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism.

    This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism. i) If the bottom strand of the sequence is the template strand and the top strand is the coding strand, circle the answer below that best represents the direction that RNA polymerase would move along the template DNA strand. Left to Right    Right to Left Lagging to Leading    A site to P site ii) Given the information in 6 i, write the sequence of the mRNA...

  • You are told that in the DNA sequence below the bottom strand is the coding strand....

    You are told that in the DNA sequence below the bottom strand is the coding strand. 5' - CCTAAGGGTTAA - 3' 3' - GGATTCCCAATT - 5' If this sequence were to be transcribed, what would the sequence of the messenger RNA be? 5' - UUAACCCUUAGG - 3' This is the answer, can someone explain how you get this answer.

  • You are told that in the DNA sequence below the bottom strand is the coding strand....

    You are told that in the DNA sequence below the bottom strand is the coding strand. 5' - ATGTTTAGCGCC - 3' 3' - TACAAATCGCGG - 5' If this sequence were to be transcribed, what would the sequence of the messenger RNA be? a 3' - GGCGCUAAACAU - 5' b 5' - CCGCGAUUUCUA - 3' c 3' - CCGCGAUUUCUA - 5' d 5' - GGCGCUAAACAU - 3'

  • The gene in the diagram is transcribed by RNA polymerase from left to right. If the...

    The gene in the diagram is transcribed by RNA polymerase from left to right. If the primary transcript in the diagram has the sequence 5' AAAAGGGGGGAUGGGG...3, the DNA strand with the sequence 5' AAAAGGGGGGATGGGG....3' would be found in the DNA strand labeled transcribed region promoter W exon intron exorn primary transcriptS

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT