HomeworkLib
Question

If a gene had the DNA sequence 5-GCTTGA-3 in the nontemplate (sense) strand of its RNA-coding region, what sequence would end up in the RNA when this gene is transcribed? Select one: a. 5-CGAACU-3 b. 5-AGUUCG-3 c. 5-GCUUGA-3 d. 5-UCAAGC-3 X

science   biology   
0 0
Add a comment Improve this question Transcribed image text
Next > < Previous
Sort answers by oldest

Homework Answers

Answer #1

PAGE NO.: DATE: I I Sense stand d DNA that har sama uonoe Ina autisense Shand an its

0 0
Add a comment
Know the answer?
Add Answer to:
If a gene had the DNA sequence 5-GCTTGA-3' in the nontemplate (sense) strand of its RNA-coding...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions

  • QUESTION 6 The DNA sense (coding) strand for a particular amino acid is 5'-CAT-3'. What RNA...

    QUESTION 6 The DNA sense (coding) strand for a particular amino acid is 5'-CAT-3'. What RNA sequence would be transcribed for this codon, what tRNA anticodon would recognize it, and what amino acid would be added in response to this codon? O 5'-UUU-3' (RNA sense); 3'-AAA-5' (tRNA anticodon); phenylalanine O 5'-CAU-3' (RNA sense); 3'-GUA-5' (tRNA anticodon); histidine O 5'-CAU-3' (RNA sense); 3'-AUG-5’ (tRNA anticodon); tyrosine O 3'-AUG-5' (RNA sense); 3'-UAC-5' (TRNA anticodon); valine QUESTION 7 The “wobble” base is less...

  • DNA sequence of a one strand of a gene to be transcribed is: 3’ — AGTCCGATGGGCT...

    DNA sequence of a one strand of a gene to be transcribed is: 3’ — AGTCCGATGGGCT GA — 5’ the sequence of the MRNA is: 3’ — AGUCCGAUGGGCTGA — 5’ the sequence of the DNA strand shown above is that of the: a. template strand b. coding strand

  • You are told that in the DNA sequence below the bottom strand is the coding strand....

    You are told that in the DNA sequence below the bottom strand is the coding strand. 5' - ATGTTTAGCGCC - 3' 3' - TACAAATCGCGG - 5' If this sequence were to be transcribed, what would the sequence of the messenger RNA be? a 3' - GGCGCUAAACAU - 5' b 5' - CCGCGAUUUCUA - 3' c 3' - CCGCGAUUUCUA - 5' d 5' - GGCGCUAAACAU - 3'

  • The NONTEMPLATE strand of a gene includes the following thefollowing sequence: 5'-AACAGCATCACC-3'. What amino acid...

    The NONTEMPLATE strand of a gene includes the following the following sequence: 5'-AACAGCATCACC-3'. What amino acid sequence will be generated when this gene is transcribed and translated?A. N-val-ala-asp-gly-CB. N-gly-asp-ala-val-CC. N-thr-ile-ser-asn-CD. N-pro-leu-arg-gln-CE. N-asn-ser-ile-thr-C 

  • You are told that in the DNA sequence below the bottom strand is the coding strand....

    You are told that in the DNA sequence below the bottom strand is the coding strand. 5' - CCTAAGGGTTAA - 3' 3' - GGATTCCCAATT - 5' If this sequence were to be transcribed, what would the sequence of the messenger RNA be? 5' - UUAACCCUUAGG - 3' This is the answer, can someone explain how you get this answer.

  • Given the following DNA sequence (it is the sense/nontemplate strand): 5’ CGTCTAATGAGgaattatgagGCACGTTGACTCGGgacttcatgGCTGACATCC 3’ If the bolded...

    Given the following DNA sequence (it is the sense/nontemplate strand): 5’ CGTCTAATGAGgaattatgagGCACGTTGACTCGGgacttcatgGCTGACATCC 3’ If the bolded Guanine is depurinated such that it now pairs with an Adenine, what kind of mutation would result upon replication? How could you describe what happens to the polypeptide that is made? What is the resulting polypeptide? If an Adenine is inserted between the two bolded “T”s what kind of mutation is this? How would we describe what happens to the polypeptide that is made?...

  • 4. Imagine the following DNA sequence is a real sequence of a gene (coding strand). This...

    4. Imagine the following DNA sequence is a real sequence of a gene (coding strand). This gene has only one exon meaning no sequence is spliced out during RNA processing. a) What will be the amino acid sequence this gene codes for? 15 points will be given for a completely correct amino acid sequence. You can get partial points if: the beginning of the amino acid sequence is correct (at least two first amino acids, 4 points), and/or the end...

  • Gene Expression Exercise Located below is a gene sequence from the coding strand of DNA 5’ATGCCCGGGTGTCGTAGTTGA3’...

    Gene Expression Exercise Located below is a gene sequence from the coding strand of DNA 5’ATGCCCGGGTGTCGTAGTTGA3’ Complete the complementary sequence for the template strand. _________________________________________________ What would the mRNA be based upon the template strand above? mRNA___________________________________________ What would the primary linear structure of the protein be based upon the mRNA strand above? Intro to Biology 1005

  • The strand below is a piece of DNA coding strand 5' - ACTCCGGGTGAGGTATCAAT - 3' Its...

    The strand below is a piece of DNA coding strand 5' - ACTCCGGGTGAGGTATCAAT - 3' Its reading frame is set and it can be seen in the middle of the gene sequence. Write out its mRNA strand sequence.

  • “Unlike what happens in DNA replication, where both strands are copied, only one of the two...

    “Unlike what happens in DNA replication, where both strands are copied, only one of the two strands is transcribed into mRNA. The DNA strand that contains the gene is sometimes called the sense strand, or coding strand, and the DNA strand that gets transcribed to give RNA is called the antisense strand, or noncoding strand. Because the sense strand and the antisense strand are complementary, and because the DNA antisense strand and the newly formed RNA strand are also complementary,...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT