30.
Point mutation may be -
31.
Original DNA sequence (coding strand), starting at the beginning of the gene: Normal: 5'-ATGATCTCCTAATACAA... Mutation: 5'-TTGATCTCCTAATACAA......
Original DNA sequence (coding strand), starting at the beginning of the gener Normal: 5-ATGATCTCCTAATACAA... Mutation: 5'-TTGATCTCCTAATACAA... 30. Can a single nucleotide be a conserved sequence? Explain your answer. (4 points) 31. Explain why self-splicing introns support the RNA world first Hypothesis (life evolved via RNA). (3 Points) 32. How can the speed of DNA replication increase, while the rate of replication remains constant7 For example, if each chromosome in the human genome initiates DNA replication, at a rate of 50...
4. Imagine the following DNA sequence is a real sequence of a gene (coding strand). This gene has only one exon meaning no sequence is spliced out during RNA processing. a) What will be the amino acid sequence this gene codes for? 15 points will be given for a completely correct amino acid sequence. You can get partial points if: the beginning of the amino acid sequence is correct (at least two first amino acids, 4 points), and/or the end...
If a gene had the DNA sequence 5-GCTTGA-3' in the nontemplate (sense) strand of its RNA-coding region, what sequence would end up in the RNA when this gene is transcribed? Select one: a. 5'-CGAACU-3' b. 5'-AGUUCG-3' c. 5'-GCUUGA-3' d. 5'-UCAAGC-3' X
5. About double strand DNA repair, it is correct to say that choose the most appropriate answer): (a) It requires one intact strand as a template for error correction. (b) Mismatches in the DNA are usually corrected via double strand DNA repair mechanisms. (c) Homologous recombination usually results in DNA repair with no loss of nucleotide at repair site. (d) Non-homologous end-joining usually results in DNA repair with no loss of nucleotide at repair site. 6. A eukaryote gene has two introns and three exons....
Gene Expression Exercise Located below is a gene sequence from the coding strand of DNA 5’ATGCCCGGGTGTCGTAGTTGA3’ Complete the complementary sequence for the template strand. _________________________________________________ What would the mRNA be based upon the template strand above? mRNA___________________________________________ What would the primary linear structure of the protein be based upon the mRNA strand above? Intro to Biology 1005
11. A gene is best defined as a. A segment of DNA b. Three nucleotides that code for an amino acid. C. A sequence of nucleotides in DNA that codes for a functional product. d. A sequence of nucleotides in RNA that codes for a functional product. e. A transcribed unit of DNA. 12. Which of the following statements is false? a. DNA polymerase joins nucleotides in one direction only. b. The leading strand of DNA is made continuously c....
You are told that in the DNA sequence below the bottom strand is the coding strand. 5' - CCTAAGGGTTAA - 3' 3' - GGATTCCCAATT - 5' If this sequence were to be transcribed, what would the sequence of the messenger RNA be? 5' - UUAACCCUUAGG - 3' This is the answer, can someone explain how you get this answer.
region is a DNA sequence that regulates transcription. Within a gene, a region is a DNA sequence that encodes RNA and a o coding, barcoding o control, coding o noncoding, control o coding, control During transcription, the DNA template is read in the ___direction. o 3 to 5 oC to N terminal ON to C terminal 0 5' to 3' For genes encoding protein, which of the following is the eukaryotic consensus sequence of the promoter? ATAT o GCGC CGCG...
1. Do all parts: a. The sequence of a gene on mRNA is normally AUGCCCGACUUU. The point mutation in the gene results in the MRNA sequence AUGCCGGACUUU. What are the amino acid sequence for the normal and mutant proteins? Say, with an explanation whether you expect this to be a silent mutation. b. Why is DNA polymerase said to be template-directed? If a RNA had the nucleotide sequence 5'-AUGCCAUAACGAUACCCCAGUC-3', what was the sequence of the DNA strand that was transcribed...
A DNA coding sequence of ATGCGTGGA(sequence for the rest of the gene)AATTAA encodes a protein chain of 200 amino acids of MET-ARG-GLY-(196 more amino acids)-ASN after splicing. A mutation occurs in which the third G is changed to a T. Using the genetic code below, determine which type of mutation this is and briefly explain how translation will be affected for this protein chain.