Question

TalA is a gene that encodes for transaldolase, which is an enzyme in the pentose-phosphate pathway....

TalA is a gene that encodes for transaldolase, which is an enzyme in the pentose-phosphate pathway. TalA is a member of the CRP regulon and CRP represses expression of talA. Would talA be expressed when there is a high glucose concentration? Explain your answer.

0 0
Add a comment Improve this question Transcribed image text
Answer #1

CRP can bind to the DNA when cAMP is present in the cell, that is CRP binds to the cAMP so that it becomes active when glucose levels are high adenylate cyclase is inactivated so cAMP is not produced in the cell, so CRP is in the inactive state, it cannot bind to the DNA. so when the concentration of glucose is high in the cell CRP cannot bind to the DNA and repress the talA so talA is expressed when the cell has high concentrations of glucose.

Add a comment
Know the answer?
Add Answer to:
TalA is a gene that encodes for transaldolase, which is an enzyme in the pentose-phosphate pathway....
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Glucose-6-phosphate dehydrogenase is a rate-limiting cytosolic enzyme controlling the pentose phosphate pathway whereas glucose-6-phosphatase is an...

    Glucose-6-phosphate dehydrogenase is a rate-limiting cytosolic enzyme controlling the pentose phosphate pathway whereas glucose-6-phosphatase is an enzyme found mainly in the liver and kidney that hydrolyzes glucose-6-phosphate and plays a major role in glucose homeostasis. These enzymes are often confused and their deficiencies cause serious metabolic complications. Explain in detail the biochemistry behind the deficiency of these enzymes in an individual and their clinical manifestations. 20 marks

  • Section: 14.4 Gluconeogenesis Section 14.5 13) The oxidative phase of the pentose phosphate pathway: a converts...

    Section: 14.4 Gluconeogenesis Section 14.5 13) The oxidative phase of the pentose phosphate pathway: a converts pentoses to hexoses. b. produces ribulose-5-phosphate and NADPH for biosynthetic processes. c. is reversible under physiological conditions. d. has an enzyme requiring thiamine pyrophosphate as a coenzyme. Section: 14.5 Pentose Phosphate Pathway of Glucose Oxidation 14) The nonoxidative phase of the pentose phosphate pathway: a. has a heptose intermediate. b. is irreversible under physiological conditions. c. is impaired in glucose-6-phosphate dehydrogenase deficiency. d. is...

  • The first enzyme in the pentose phosphate pathway that oxidize glucose glucose-6-phosophate to 6- phosphoglucono-6-lactone is...

    The first enzyme in the pentose phosphate pathway that oxidize glucose glucose-6-phosophate to 6- phosphoglucono-6-lactone is glucose-6-phosophate dehydrogenase. Deficiency of this enzyme causes health issues. Write 2-1 page description on the deficiency of the enzyme due to genetic mutations. (if this enzyme activity has completely diminished due to mutation, we cannot live). Include these terms in your writing and underline them whenever you use the terms. Red blood cells, hemolytic anemia, fava beans, malaria, malaria drugs glutathione, NADPH

  • QUESTION 2 (A) The pentose phosphate pathway is comprised of two phases. Why are both phases...

    QUESTION 2 (A) The pentose phosphate pathway is comprised of two phases. Why are both phases necessary for the survival of the cell? (2pts) (B) In the non-oxidative phase of the pentose phosphate pathway ribose 5-phosphate is converted to fructose 6-phosphate. Why does this pathway require so many enzymatic steps? What benefit does each step provide? (4 pts) (C) Many cancer drugs are effective because they reduce cell proliferation by reducing the amount of base material needed for cell division...

  • There are 3 parts to this question (AC) 5. Concerning the pentose phosphate pathway. A In...

    There are 3 parts to this question (AC) 5. Concerning the pentose phosphate pathway. A In the nonoxidative phase of the pentose phosphate pathway, from where does the xylulose-5-phosphate come? B. At the end of the nonoxidative portion of the pentose phosphate pathway the result is 2 molecules of fructose-6-phosphate and 1 molecule of glyceraldehyde-3-phosphate Toget this, how many times did the oxidative phase have to run lie, how many glucose-6-phosphate molecules were used? C. How many total NADPH will...

  • Metabolic Pathway Engineering Problem Set 5 Engineering a Fermentation System: Fermentation of plant matter to produce...

    Metabolic Pathway Engineering Problem Set 5 Engineering a Fermentation System: Fermentation of plant matter to produce ethanol for fuel is one potential method for reducing the use of fossil fuels and thus the CO2 emissions that lead to global warming. Many microorganisms can break down cellulose then ferment the glucose to ethanol. However, many potential cellulose sources, including agricultural residues and switchgrass, also contain substantial amounts of arabinose, which is not as easily fermented. Escherichia coli is capable of fermenting...

  • 1. What transcript is produced from this gene? 5’ ATTGTGAGCAGGAAGAGAGT 3’ 3’ TAACACTCGTCCTTCTCTCA 5’ A) 5’AUUGUGAGCAGGAAGAGAGU3’...

    1. What transcript is produced from this gene? 5’ ATTGTGAGCAGGAAGAGAGT 3’ 3’ TAACACTCGTCCTTCTCTCA 5’ A) 5’AUUGUGAGCAGGAAGAGAGU3’ B) 5’ACUCUCUUCCUGCUCACAAU3’ C) 5’UAACACUCGUCCUUCUCUCA3’ D) 5’UGAGAGAAGGACGAGUGUUA3’ 2.If the anticodon is 5’CAU 3’, what codon on the mRNA will it bind? 3.The lac operon is ON in which situation: A) Low glucose low lactose B) Low glucose high lactose C) High glucose high lactose D) High glucose low lactose 4.You have isolated an E. coli mutant that has a deletion of the gene encoding the...

  • Genetics Worksheet Week 3: Gene Regulation and Epigenetics 1. Duchenne muscular dystrophy is caused by a mutation in a gene that is 2.5 million nucleotides in length and encodes a protein called dyst...

    Genetics Worksheet Week 3: Gene Regulation and Epigenetics 1. Duchenne muscular dystrophy is caused by a mutation in a gene that is 2.5 million nucleotides in length and encodes a protein called dystrophin. The dystrophin protein itself is 3684 amino acids in length. Calculate below the approximate size of the mRNA that encodes dystrophin. Approximately what percentage of the gene that encodes dystrophin is intron sequence? The human genome encodes a much greater variety and number of proteins than the...

  • The gene machine program shows you what happens when lactose is present in E. coli, and...

    The gene machine program shows you what happens when lactose is present in E. coli, and how the lac operon is under negative control. However, the lac operon is also under positive control from a protein called CRP, eAMP Receptor Protein. The absence of the lac repressor is essential but not sufficient for effective transcription of the lac operon. RNA polymerase also depends on the presence of CRP. Like the lac repressor, which can bind to the DNA and lactose....

  • You hypothesize that a DNA sequence located 3.0 kb upstream of the promoter of a gene...

    You hypothesize that a DNA sequence located 3.0 kb upstream of the promoter of a gene you are studying contains an enhancer. To test your hypothesis, you use recombinant DNA techniques to insert a DNA fragment containing this DNA sequence into a plasmid also containing a “reporter gene.” Note:A reporter gene encodes for a protein that you can detect when expressed. For example, you could use the lacZ gene that encodes for the enzyme β-Galactosidase as a reporter gene. As...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT