Question

The following is part of the original in vitro translation data obtained by Dr. Har Gobind Khorana:

Synthetic mRNA Polypeptide synthesized (AC), (i.e., ACACAC......) (Thr-His). (AUC), (lle-lle), and (Ser-Ser), and (His-His).

Hint: Remember that there is often wobble in the third position of the codon.

A) What is/are the codons for Ile? _______

B) What is/are the codons for His? ____

C) What is/are the codons for Ser? ____

D) What is/are the codons for Thr? _____

0 0
Add a comment Improve this question Transcribed image text
Answer #1

D ACACACACACACACAC codons are ACA .The CAC- His 2) AUCAUC AUC AUCAUC Auc codons are Auc UCA CAU Ser His 3) UCGUCGUCGUCGUCG codifferent codons in the sequence are obtained, in each reading frame there are three reading frames, first reading frame starts with the first nucleotide, the second reading frame starts with the second nucleotide, and the third reading frame starts with the third nucleotide. In all three sequences in all the reading frames all the codons are same.

a) codons for Ile is

AUC.

b) codons of Histidine are

CAU, CAC.

c) codons for serine are

UCA, UCG

d) Codons for Thr is ACA

Add a comment
Know the answer?
Add Answer to:
The following is part of the original in vitro translation data obtained by Dr. Har Gobind...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • If mutations occur at random, and changes to 1st or 2nd "letter" of a codon usually...

    If mutations occur at random, and changes to 1st or 2nd "letter" of a codon usually changes the amino acid coded for, but changes to the 3rd "letter" rarely do, roughly what % of mutations should be synonymous? Second АТ G UUU Phe UCU Ser UAU Tyr UGU Cys U 0 C | Phe UCC Ser UAC Tyr UGC Cys C Leu UCA Ser UAA Stop UGA Stop UUG Leu UCG Ser UAG Stop UGG Trp G CUU Leu CCU...

  • QUESTION 32 The genetic code was deciphered in part by experiments in which synthetic polynucleotides were...

    QUESTION 32 The genetic code was deciphered in part by experiments in which synthetic polynucleotides were used as mRNAs to direct protein synthesis in cell-free extracts (in-vitro system). In the test tube, artificial conditions were used that allowed ribosomes to start protein synthesis anywhere on an RNA molecule, without the need of a translation start codon, as required in a living cell. What type(s) of polypeptides would you expect to be synthesized if the polynucleotide 5'- CAUCAUCAUCAUCAUCAUC...-3' were used as...

  • Question 10 (15 points) Given the following sequence for a template strand of DNA 3 -...

    Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...

  • 2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the...

    2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...

  • TTA Assignment 5 Finals Review oints) For splicing, introns are identified by the spliceosome by the...

    TTA Assignment 5 Finals Review oints) For splicing, introns are identified by the spliceosome by the following sequences: on the 5 side of the on: AAGT on the 3' end of the intron: CAGG. In the following DNA sequence, identify the splice sites, introns and ACAGG NA: A A GCG TAATTACTTACAGGTGGACATATCGTTATAGGCGT-3 TATTAATGAATGTACACGAGTATAGCAATATCCGCT-5' 'CAATGGAT What is the protein sequence once the mRNA is spliced (Use the codon chart on the last page? a. sequence bee as mutated to CTG G A...

  • 2) On your first day working in my lab, you obtain the following DNA sequence: 3'...

    2) On your first day working in my lab, you obtain the following DNA sequence: 3' AATTATACACGATGAAGCTTGTGACAGGTTTCCAATCATTAA 5 5' TTAATATGTGCTACTTCGAACACTGTECCAAAGGTTAGTAATT 3' a) What are the two possible RNA molecules that could be transcribed from this DNA? Indicate the 5' and 3' ends of the RNA. b) Only one of these two RNA molecules can actually be translated. Explain why. c) It turns out that the RNA molecule that can be translated is the mRNA for p53. What is the amino...

  • You are synthesizing messenger RNAs in vitro with bases incorporated in random sequences with the ratio...

    You are synthesizing messenger RNAs in vitro with bases incorporated in random sequences with the ratio of 16:3A. What is the probability of obtaining a glycine (gly) codon? second base U UAU tyr DỤC phe UUA leu UACS UAA Stop UAG Stop G UGU UGC ſys UGA Stop UGG trp CGU CGC CAU , his CÁC his CỦA / leu CAA 1. arg CGA с UUU 2 UCU UCC ser UCA UUG) UCG CUU CCU CUC CCC CCA } pro...

  • Hello please please help !! Thank you!! Please and thank you soo much!!! Question Completion Status:...

    Hello please please help !! Thank you!! Please and thank you soo much!!! Question Completion Status: Question 10: The genetic code consists of 64 triplets of nucleotides (called codons). Each codon (with the exception of the 3 stop codons) encodes for one of the 20 amino acids used in the synthesis of proteins. This produces some redundancy in the code as most amino acids are encoded by more than one codon. One codon, AUG serves two related functions: it signals...

  • C++ Help Task B: Translation While a nucleotide is the basic unit of information, three nucleotid...

    C++ Help Task B: Translation While a nucleotide is the basic unit of information, three nucleotides, or codon, is the basic unit of storage. The reason for this is that each gene codes for a protein, and all proteins are made from 20 amino acids. Recall that there are 4 different bases that make up dna. Thus, three bases can encode for 4x4x4 = 64 different symbols. Two base pairs can only encode for 4x4 = 16 symbols, which is...

  • Follow the instructions below to answer questions about Replication, Transcription & Translation. 3’- T   A   C...

    Follow the instructions below to answer questions about Replication, Transcription & Translation. 3’- T   A   C A   C   C   G   G   T   C   A   G   G   T   G A   T   C -5’ A. Imagine that the sequence shown represents one strand of a gene sequence. What would be the sequence of the complementary strand of DNA? Write out your answer, indicating correct polarity (5' and 3' ends) on your new strand. (1.5 points) B. Now imagine that the new strand...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT