Question

U C A G UUU · UCU 1 UAU U Phe 1 UGU Tyr! UGC Cys UUC I UCC I UAC C U 1 Ser UUA UCA Leu UUG UCG CUU CCU UAA Stop UGA Stop A UA

Follow the instructions below to answer questions about Replication, Transcription & Translation.

3’- T   A   C A   C   C   G   G   T   C   A   G   G   T   G A   T   C -5’

A. Imagine that the sequence shown represents one strand of a gene sequence. What would be the sequence of the complementary strand of DNA? Write out your answer, indicating correct polarity (5' and 3' ends) on your new strand. (1.5 points)

B. Now imagine that the new strand that you just created is the coding strand when it comes to Transcription. (The strand shown at the top can thus be thought of as the template strand). Knowing that this is the case, write out the correct mRNA sequence that this gene would produce, again indicating correct polarity. (2 points)

C. The mRNA you produced in "B" is now ready to be translated! Using the Codon Table at the top of the page, provide the entire polypeptide sequence that would be produced from your mRNA. Indicate the correct polarity of your protein sequence by indicating the N-terminus and C-terminus. (2.5 points)

D. What would be the correct anticodon sequence that would be used to recognize codon #4 in your mRNA sequence? Don't forget to once again indicate polarity! (1.5 points)

E. Mutations can drastically alter the sequence of the final polypeptide produced. Show how a mutation in your mRNA sequence from “B” could result in a nonsense mutation in the final polypeptide. For full credit, write out both the modified mRNA and the modified polypeptide sequences, indicating polarityon each as before. (4 points)

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Given sequence 3- TACA CC GGICAGGI GAT C-5 of the sequence strean op would be : complementary 5- ATGT GGCCA GT CC, A CTA G

Add a comment
Know the answer?
Add Answer to:
Follow the instructions below to answer questions about Replication, Transcription & Translation. 3’- T   A   C...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Question 10 (15 points) Given the following sequence for a template strand of DNA 3 -...

    Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...

  • 2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the...

    2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...

  • Please note that Questions 15 to 17 are connected questions. Question 15: The following shows a...

    Please note that Questions 15 to 17 are connected questions. Question 15: The following shows a partial DNA sequence from the wild-type (normal) allele for the human leukemia-linked apoptotic gene.   5' ATGCGATTAATCGGTAAA 3' (non-template strand) 3' TACGCTAATTAGCCATTT 5' (template strand) Please answer the following questions: (a) If the bottom strand serves as the DNA template for transcription, what is the resulting mRNA sequence? The mRNA sequence is  5'  3'. (2 marks) 5' AUG CGA UUA AUC GGU AAA 3' ? Please enter...

  • 25. What binds to a stop codon on a mRNA during translation? a. transcription factor c....

    25. What binds to a stop codon on a mRNA during translation? a. transcription factor c. termination factor b. tRNA d. transcription initiator 26. What is typically attached to the acceptor end of a tRNA? a. a protein b. an amino acid C a ribosome d. a nucleosome 27. During mRNA processing, what is put on the 3' end of a primary mRNA transcript? a. a poly-A tail b. a cap d. an intron c. an exon 28. Which of...

  • The template strand of a given gene includes the sequence 3'-GCCACGTATCAG-5'. For each one, be sure...

    The template strand of a given gene includes the sequence 3'-GCCACGTATCAG-5'. For each one, be sure to indicate 5' and 3' ends (DNA & RNA) and N and C termini (polypeptide). What is the sequence of the nontemplate strand (a), mRNA sequence made (b) and polypeptide made (c)? Hint: They are aligned in a way that you don't have to worry about the direction, because polynucleotides grow from 5' to 3' direction. (7 pts) Second base of RNA codon 000...

  • Replication, Transcription, and Translation >> Use the provided DNA sequence to generate an amino acid sequence...

    Replication, Transcription, and Translation >> Use the provided DNA sequence to generate an amino acid sequence > Replication: use base pairing rules (A-T, C-G) to create a new strand of DNA Transcription: use the new strand of DNA to make a strand of RNA; don't forget that RNA uses U instead of T > Translation: use the genetic code to determine the amino acid sequence w BEUTE ZERBS 21 Second letter WAU) Tyr Urddon Stop UGI UAG Stop UGG Osclone...

  • Use the Mutations interactive to determine which statements describe silent mutations. The adenine of the start...

    Use the Mutations interactive to determine which statements describe silent mutations. The adenine of the start codon is position +1. a substitution from G to T in the arginine codon of the antisense stand a substitution of a G nucleotide at position +9 in the antisense strand a transition at position +6 in the sense strand a transversion of A in the histidine codon of the antisense strand a single nucleotide deletion at position +12 in the antisense strand a...

  • IOL Below cartoon OI the Iinal stages OI translation polypeptide in a prokaryote. Arg Tyr Ser...

    IOL Below cartoon OI the Iinal stages OI translation polypeptide in a prokaryote. Arg Tyr Ser — G U А с G U A CU C CAC The ribosome has fallen off the strand and needs to get back on to finish the polypeptide. There is 1 more amino acid needed before the peptide is complete and a stop codon is reached. Based on the information in the cartoon: a.) Draw the ribosome and polypeptide in the correct position to...

  • BONUS (10 points, 2 points each): Given below is a sequence of mRNA that is transcribed...

    BONUS (10 points, 2 points each): Given below is a sequence of mRNA that is transcribed from a structural and mRNA: AUG CGC GOA UCC CCC ACC AGA ACG GAX UGA-3 G-C 1. Using the codon chart provided below, write down the predicted amino acid sequence of the protein the produced from this mRNA 3-UAC GCG EXU AGG GGG UGG UCU UGC COU 2). Write down the DNA sequence of the structural pene from which this mRNA sequence is transcribed...

  • Identify the structures in DNA Need help with all of these questions Coding strand Transcription 5'-CAGACCAGTTACTGACTGGCATTCAAECATGGATCCAGTATGCCTCGACGGTTATTGGCCGAGCCCCAAGTGGTCGCTCATGGGGAGTOGTCTAGTAGCAATGEATTTAGAGGTCACTAGTCA-3"...

    Identify the structures in DNA Need help with all of these questions Coding strand Transcription 5'-CAGACCAGTTACTGACTGGCATTCAAECATGGATCCAGTATGCCTCGACGGTTATTGGCCGAGCCCCAAGTGGTCGCTCATGGGGAGTOGTCTAGTAGCAATGEATTTAGAGGTCACTAGTCA-3" Transcription start site → stop site 3-GTQTGGTCAATATAATGACETAAGTTCGTACCTAGGTCATACGGAGCTGCCAATAACCGGCTCGGGGTTCÁCCAGCGAGTACCCGTCACCAGATCATCGTTACGTAATGTCCAGTGATCAGT-5' VI VII VIII Template strand Label Identify the structure Function Is the structure part of a mature mRNA? (Y/N) DTY What is the amino acid sequence produced from this locus? Identify N/C terminus and use the three- letter abbreviation on the codon chart VA Tyrone Tyd O ne Oy VAA Stop Trutnohon SA Histidin Hesi GAA Gent...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT