Question

1. Explain the difference between an intron and an exon. 2. Why do the two possible PCR products differ in size by 300 base p
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Answer

1. There are the following differences between exon and intron

  1. Exon is a sequence of DNA which present in the mature RNA whereas Intron is the part of DNA which does not present in the mature RNA
  2. Exon is the coding region of DNA which translated into protein whereas into is the noncoding region of DNA.
  3. intron present in the mostly eukaryotic genome

2. PCR products differ in size by 300bp possibly because of the deletion od certain parts of DNA.

3. Agarose gel separate DNA fragments on the basis of molecular weight, smaller DNA move faster than larger DNA because of smaller DNA can easily move in the pore size of gel therefore move faster.   

Add a comment
Know the answer?
Add Answer to:
1. Explain the difference between an intron and an exon. 2. Why do the two possible...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Gel Electrophoresis of Amplified PCR Samples 9. What is Alu? 10. Why is Alu useful for...

    Gel Electrophoresis of Amplified PCR Samples 9. What is Alu? 10. Why is Alu useful for studying human ancestry? 11. Why do the two possible PCR products from our lab differ in size by 300 base pairs? 12. Explain how gel electrophoresis separates DNA fragments 13. Fill in the table below. For each genotype, write how many DNA bands (fragments) you would expect to see in a gel, along with the size of each (n base pairs) Table 1. Predicted...

  • 1. Explain the differences between an intron and an exon? (4pts) 2. Why do you see...

    1. Explain the differences between an intron and an exon? (4pts) 2. Why do you see different size bands in Homozygous recessive, Homozygous dominant and Heterozygous student sample in PTC experiment? (4pts) 3. In the PTC lab, we determined the frequency of two alleles, the "+allele" and the "- allele" in a sample population (our class). What was the difference between these two alleles? (4pts) 4. Define evolution be sure to include in your definition what actually evolves. (Spts) 5....

  • One strand of a DNA sequences is given below. Find the EcoRI sites and indicate the...

    One strand of a DNA sequences is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...

  • 1. Explain why, when PCR is used to amplify the same region of DNA from two...

    1. Explain why, when PCR is used to amplify the same region of DNA from two different people, the size of the DNA fragment(s) generated may be different? 2. What characteristic of the DNA molecule makes it possible to use electrophoresis to separate DNA molecules by size? Explain why this characteristic is important for electrophoresis and what part of the DNA molecule creates this characteristic. 3. You are performing PCR. After four cycles of PCR, how many double-stranded copies of...

  • Biologists use gel electrophoresis to sort DNA segments by size. DNA segments are placed at one...

    Biologists use gel electrophoresis to sort DNA segments by size. DNA segments are placed at one end of a gel. DNA is negatively charged (with a charge of two electrons per base pair). When you “run the gel” you are generating an electric field by connecting anodes and cathodes at the ends of the gel. This causes the negatively charged DNA segments to move towards the positive electrode. After running the gel, smaller DNA segments have moved farther from the...

  • En (2 points) You isolated your mitochondrial DNA in Part I. In step 6, you discard...

    En (2 points) You isolated your mitochondrial DNA in Part I. In step 6, you discard the supernatant, but keep the pellet. In step 15, you discard the pellet, but keep the supernatant. Explain why the pattern is different between the two steps and the consequence of mixing up these two steps. Procedure Part 1: mt DNA Isolation from your cheek cells. Lysis solution is used to breakdown the cells in this step, you will isolate MEONA from cheek cells....

  • Question 4-12 points Biologists use gel electrophoresis to sont DNA segments by size. DNA segments are...

    Question 4-12 points Biologists use gel electrophoresis to sont DNA segments by size. DNA segments are placed at one end of a gel. DNA is negatively chargod (with a charge of two electrons per base pair). When you "run the gel" you are generating an electric field by connecting anodes and cathodes at the ends of the gel This causes the negatively charged DNA segments to move towards the positive electrode. After nunning the gel, smaller DNA segments have moved...

  • Can someone explain this, I do not understand, I have the answer but I just don't understand why? Question 1. Consider the segment of DNA below, taken from several CCNY rattus. From each rat,...

    Can someone explain this, I do not understand, I have the answer but I just don't understand why? Question 1. Consider the segment of DNA below, taken from several CCNY rattus. From each rat, the fragment was amplified using the primers shown. Some of the amplification product was immediately run on a DNA agarose gel: the remainder was treated with EcoRI, then run on a separate gel. On the gel representation below, show where each DNA fragment would migrate for...

  • I need the answers for questions 2 and 3. My DNA ladder is in lane 2...

    I need the answers for questions 2 and 3. My DNA ladder is in lane 2 marked by the yellow arrow. Thanks! Here is the only other info I have. Thanks! Part 2: Gel purification and on Gel Slice and PCR Product Preparin modified from TBSci.com instructions for gaan A. Dissolving the Gel Stie Following electrophores, eral DNA band from grand place glice microcentrifuge tube Ib. Use an analytical balance to weigh pelice Rec die 2. Add 500 balance to...

  • 8. You are studying a newly identified chromatin-remodeling complex, which you call NICRC. You decide to...

    8. You are studying a newly identified chromatin-remodeling complex, which you call NICRC. You decide to run an in vitro experiment to characterize the activity of the purified complex. Your molecular toolbox includes: (1) a 400-base-pair DNA molecule that has a single recognition site for the restriction endonuclease EcoRI, an enzyme that cleaves internal sites on double-stranded DNA (dsDNA); (2) purified EcoRI enzyme; (3) purified DNase I, a DNA endonuclease that will cleave dsDNA at nonspecific sites if they are...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT