![You have identified a mutant strain of bacteria that exhibits the following responses to the presence of glucose and lactose. Transcription of LacY (off, low, or high) [Lactose] Glucose]T PreseHigh Present Off Low Off Off Absent Low](http://img.homeworklib.com/questions/cadd3f60-4273-11ec-a166-35e38994f248.png?x-oss-process=image/resize,w_560)
Homework Answers
lac operon (lactose operon) is an operon required for the transport and metabolism of lactose in Escherichia coli and other enteric bacteria. It consists of three structural genes (lacZ, lacY, and lacA), a promoter, a terminator, regulator, and an operator.
|
lac Operon Gene |
Gene Function |
||
|
I |
Gene for repressor protein |
||
|
P |
Promoter |
||
|
O |
Operator |
||
|
lac Z |
Gene for ß-galactosidase |
||
|
lac Y |
Gene for ß-galactoside permease |
||
|
lac A |
Gene for ß-galactoside transacetylase |
||
|
Mutant lac gene |
Mutant Phenotype |
||
|
I- |
constitutive expression because the operator is never closed |
||
|
O- |
constitutive expression because the repressor protein can not bind |
||
|
P- |
no expression of the operon because RNA polymerase cannot bind |
||
|
lac Z- |
no glucose or galactose production from lactose |
||
|
lac Y- |
no induction because lactose will not be taken into the cell |
||
Therefore, in mutant strain (lac Y-) of bacteria there will be no induction of lac operon because lactose will not be taken into the cell
Add Answer to:
You have identified a mutant strain of bacteria that exhibits the following responses to the presence...
25. You take your lac/ strain and transform in two F' plasmids to conduct a complementation...
25. You take your lac/ strain and transform in two F' plasmids to conduct a complementation test. The first F' plasmid contains the entire lac operon from a strain that is lacz, while the second F' plasmid contains the entire lac operon from a strain that is lacY. You test the ability of the transformed bacteria to grow on media where the sole carbon source is either glucose or lactose, and obtain the following results: Lac t mutant compl lacZ...
Consider an E. coli strain carrying a mutation in crp (encoding the catabolite activator protein) that...
Consider an E. coli strain carrying a mutation in crp (encoding the catabolite activator protein) that prevents CAP from binding CAMP. Predict whether the repressor and the activator is active (able to bind to DNA) or inactive (unable to bind to DNA), and the level of transcription in the following scenarios. Options for transcription levels include high, medium, leaky and off. a. When lactose is present but glucose is not, the repressor is and the activator is leading to levels...
Under which of the following conditions will transcription of the lac operon occur when the bacteria...
Under which of the following conditions will transcription of the lac operon occur when the bacteria are originally inoculated in a medium containing both glucose and lactose? a) Lactose present/glucose present b) Lactose present/glucose used up c) Lactose absent/glucose present d) Lactose absent/glucose used up e) a and b
You are studying a mutant strain of bacteria in which the trp operon includes a mutation...
You are studying a mutant strain of bacteria in which the trp operon includes a mutation in region 1 of the 5'UTR. Whereas in the wildtype strain the affected codons code for "trp, in the mutant strain these codons code for "stop". How will this mutation affect attenuation? Translation of the S'UTR will stop at the position of the mutation in region 1. As a result, region 3 of the 5'UTR will pair with region 2 in the mRNA causing...
1. Describe how bacteria regulate genes through operons. 2. What is the difference between a repressible...
1. Describe how bacteria regulate genes through operons. 2. What is the difference between a repressible and inducible genetic system? 3. Expression of the Lac operon is under the controls of (1) the Lacl repressor and (2) CAP. Consider each of the following conditions and determine which factors will be acting on the operon. Predict the rate of gene expression. Conditions Lac Operon fon" or "off" CAP present" or "absent" at Lac Operon Predict the rate of gene expression (none,...
Consider what you know about the lac operon, and predict whether the repressor and the activator...
Consider what you know about the lac operon, and predict whether the repressor and the activator is active (able to bind to DNA) or inactive (unable to bind to DNA), and the level of transcription in the following scenarios. Options for transcription levels include high, medium, leaky and off. a. When lactose is present but glucose is not, the repressor is and the activator is leading to levels of transcription. and the activator is b. When lactose and glucose are...
Imagine you are carrying out research on the lac operon. You isolate six mutations in the...
Imagine you are carrying out research on the lac
operon. You isolate six mutations in the lac operon by
measuring the amount of beta-galactosidase made in mutant cell line
under three different conditions: no lactose/no glucose; lactose
only; and lactose/glucose. Your results are shown in the table.
Strain
No Lactose, No Glucose
Lactose
Lactose, Glucose
Wild-type
None
High
Low
Mutant 1
None
None
None
Mutant 2
None
None
None
Mutant 3
None
Low
Low
Mutant 4
None
Low
Low
Mutant...
1. What transcript is produced from this gene? 5’ ATTGTGAGCAGGAAGAGAGT 3’ 3’ TAACACTCGTCCTTCTCTCA 5’ A) 5’AUUGUGAGCAGGAAGAGAGU3’...
1. What transcript is produced from this gene?
5’ ATTGTGAGCAGGAAGAGAGT 3’
3’ TAACACTCGTCCTTCTCTCA 5’
A) 5’AUUGUGAGCAGGAAGAGAGU3’
B) 5’ACUCUCUUCCUGCUCACAAU3’
C) 5’UAACACUCGUCCUUCUCUCA3’
D) 5’UGAGAGAAGGACGAGUGUUA3’
2.If the anticodon is 5’CAU 3’, what codon on the mRNA will it
bind?
3.The lac operon is ON in which situation:
A) Low glucose low lactose
B) Low glucose high lactose
C) High glucose high lactose
D) High glucose low lactose
4.You have isolated an E. coli mutant that has a deletion of the
gene encoding the...
2. Suppose you have six strains of E. coli. One is wild type, and each of the other five has a single one of the follow...
2. Suppose you have six strains of E. coli. One is wild type, and each of the other five has a single one of the following mutations: lacZ, lacY, laď·0; and lach. For each of these six strains, describe the phenotype you would observe using the following assays. Explain your answers. [Notes: (1) IPTG is a colorless synthetic molecule that acts as an inducer of lac operon expression but cannot serve as a carbon source for bacterial growth because it...
A. Which strain is the wild-type E.coli? Explain how you know this. B. Which strain contains...
A. Which strain is the wild-type E.coli? Explain how you know
this.
B. Which strain contains the nonsense mutation in the CRP
protein gene? Explain how you know this.
C. Which strain contains the deletion mutation in the lac operon
operator sequence? Explain how you know this.
knowledge about the lac operon system AND knowledge Problem set about the Lac operon (these problems require knowledge about the lac operon system AND about consequences of mutations) You are working with three...
25. You take your lac/ strain and transform in two F' plasmids to conduct a complementation test. The first F' plasmid contains the entire lac operon from a strain that is lacz, while the second F' plasmid contains the entire lac operon from a strain that is lacY. You test the ability of the transformed bacteria to grow on media where the sole carbon source is either glucose or lactose, and obtain the following results: Lac t mutant compl lacZ...
Consider an E. coli strain carrying a mutation in crp (encoding the catabolite activator protein) that prevents CAP from binding CAMP. Predict whether the repressor and the activator is active (able to bind to DNA) or inactive (unable to bind to DNA), and the level of transcription in the following scenarios. Options for transcription levels include high, medium, leaky and off. a. When lactose is present but glucose is not, the repressor is and the activator is leading to levels...
You are studying a mutant strain of bacteria in which the trp operon includes a mutation in region 1 of the 5'UTR. Whereas in the wildtype strain the affected codons code for "trp, in the mutant strain these codons code for "stop". How will this mutation affect attenuation? Translation of the S'UTR will stop at the position of the mutation in region 1. As a result, region 3 of the 5'UTR will pair with region 2 in the mRNA causing...
1. Describe how bacteria regulate genes through operons. 2. What is the difference between a repressible and inducible genetic system? 3. Expression of the Lac operon is under the controls of (1) the Lacl repressor and (2) CAP. Consider each of the following conditions and determine which factors will be acting on the operon. Predict the rate of gene expression. Conditions Lac Operon fon" or "off" CAP present" or "absent" at Lac Operon Predict the rate of gene expression (none,...
Consider what you know about the lac operon, and predict whether the repressor and the activator is active (able to bind to DNA) or inactive (unable to bind to DNA), and the level of transcription in the following scenarios. Options for transcription levels include high, medium, leaky and off. a. When lactose is present but glucose is not, the repressor is and the activator is leading to levels of transcription. and the activator is b. When lactose and glucose are...
Imagine you are carrying out research on the lac
operon. You isolate six mutations in the lac operon by
measuring the amount of beta-galactosidase made in mutant cell line
under three different conditions: no lactose/no glucose; lactose
only; and lactose/glucose. Your results are shown in the table.
Strain
No Lactose, No Glucose
Lactose
Lactose, Glucose
Wild-type
None
High
Low
Mutant 1
None
None
None
Mutant 2
None
None
None
Mutant 3
None
Low
Low
Mutant 4
None
Low
Low
Mutant...
1. What transcript is produced from this gene?
5’ ATTGTGAGCAGGAAGAGAGT 3’
3’ TAACACTCGTCCTTCTCTCA 5’
A) 5’AUUGUGAGCAGGAAGAGAGU3’
B) 5’ACUCUCUUCCUGCUCACAAU3’
C) 5’UAACACUCGUCCUUCUCUCA3’
D) 5’UGAGAGAAGGACGAGUGUUA3’
2.If the anticodon is 5’CAU 3’, what codon on the mRNA will it
bind?
3.The lac operon is ON in which situation:
A) Low glucose low lactose
B) Low glucose high lactose
C) High glucose high lactose
D) High glucose low lactose
4.You have isolated an E. coli mutant that has a deletion of the
gene encoding the...
2. Suppose you have six strains of E. coli. One is wild type, and each of the other five has a single one of the following mutations: lacZ, lacY, laď·0; and lach. For each of these six strains, describe the phenotype you would observe using the following assays. Explain your answers. [Notes: (1) IPTG is a colorless synthetic molecule that acts as an inducer of lac operon expression but cannot serve as a carbon source for bacterial growth because it...
A. Which strain is the wild-type E.coli? Explain how you know
this.
B. Which strain contains the nonsense mutation in the CRP
protein gene? Explain how you know this.
C. Which strain contains the deletion mutation in the lac operon
operator sequence? Explain how you know this.
knowledge about the lac operon system AND knowledge Problem set about the Lac operon (these problems require knowledge about the lac operon system AND about consequences of mutations) You are working with three...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 11 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 11 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 11 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 11 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 11 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 11 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 11 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 11 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 11 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 11 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 11 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 11 months ago