Question

You are studying a mutant strain of bacteria in which the trp operon includes a mutation in region 1 of the 5UTR. Whereas inYou are studying a mutant strain of bacteria in which the trp operon includes a mutation in region 1 of the 5UTR. Whereas in

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Translation of the 5' UTR will stop at the position of the mutation in the region 1. As a result region 3 of the 5'UTR will pair with region 2 in the mRNA causing transcription to continue in the structural genes.

When region 2 pairs with region 3 then antitermination loop is formed and allow transcription to continue and when region 3 pairs with region 4 if forms a termination loop which stops transcription.

Add a comment
Know the answer?
Add Answer to:
You are studying a mutant strain of bacteria in which the trp operon includes a mutation...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • You have discovered a new mutant strain of E.colithat has a mutation in the trpL gene,...

    You have discovered a new mutant strain of E.colithat has a mutation in the trpL gene, so that there are no trp codons in the resulting mRNA transcribed from this gene. Explain how this might affect the attenuation / regulation of the trp gene expression.

  • What would be the most likely effect on the transcription of the trp structural genes for...

    What would be the most likely effect on the transcription of the trp structural genes for the following mutations? mutation that prevents ribosome binding to the mRNA 5' UTR mutation that changes region 1 tryptophan codons into alanine codons mutation that creates a stop codon in region 1 of mRNA 5' UTR deletions in region 2 of the mRNA 5' UTR deletions in region 3 of the mRNA 5' UTR deletions in region 4 of the mRNA 5' UTR deletion...

  • Trp Operon 5. The rate of transcription of the trp operon in E. coli is controlled by both repression and attenuation dr papde ia) Alternate secondary structures formed by the trpl tranecript Alterna...

    Trp Operon 5. The rate of transcription of the trp operon in E. coli is controlled by both repression and attenuation dr papde ia) Alternate secondary structures formed by the trpl tranecript Alternate 2 Regions 2 and 3 Atemate 1: Regions 1 and 2 basepared and regions 3 and 4 basepsired 54 140 Stop codon Transcribtion termination hairpin can NOT form a) Diagram and explain repression and attenuation regulatory mechanisms for the trp operon when tryptophan is present and absent....

  • 1. (1 points) A deletion mutation in the leader sequence of the trp operon removes the...

    1. (1 points) A deletion mutation in the leader sequence of the trp operon removes the two tryptophan codons that are involved in attenuation. Predict the effect of this mutation on the expression of the trp structural genes in E. coli cells grown in media that lacks tryptophan. 2. (2 points) What protein family members are the main protein components of the RISC complex? How does the RISC complex target specific mRNAs for silencing? 3. (3 points) In bacteria, the...

  • Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work...

    Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work to control the levels of Trpe peptide? What happens when tryptophan levels are high in the cell? When they are low? (drawings may be used to assist in your explanation)(B) Does this happen in eukaryotes, prokaryotes or both? Why? (6 pts) Leader peptide Met-Lys - Al-te-Phe Val- mRNA PPPAAGUUCACGUAAAAAGGGUAUCGACAAUGAAAGCAAUUUUCGUACUGA GUAGUA MARCGAAAUGCGUACCACUUAUGUGACGGGCAANGUCCUUCACGCGGUGGU stop)-Ser-Thr-Arg - Trp - Top- ACCCAGCCCGCCUAAUGAGCGGGCUUUUUUUUGAACAAAAUUAGAGAAUAAGAAUGCAAACA Met-Gin-The- Trpt polypeptide Site of transcription attenuation...

  • 3. Consider a hypothetical strain of E. coli (strain 401) that contains two mutations that affect...

    3. Consider a hypothetical strain of E. coli (strain 401) that contains two mutations that affect tryptophan biosynthesis. The first mutation is a single nucleotide substitution that converts the second tandem Trp codon in region 1 of the Trp leader sequence into a stop codon (see slides 2-7 of Lecture 24 on iLearn) trp structural genes trpE trpD trpC trpB trpA PO Trp Leader Met-Lys-Ala-lle-Phe-Val-Leu-Lys-Gly-Trp-Trp-Arg-Thr Ser- Stop Assume that strain 401 also contains a mutation in the gene for the...

  • Which of the following occurs as a result of an abundance of tryptophan in E. coli?...

    Which of the following occurs as a result of an abundance of tryptophan in E. coli? A.The leader sequence is not transcribed. B.The 5 trp genes (TrpA � TrpE) are not transcribed. C.Stalling of the ribosome at trp codons in the leader sequence D. The 5 trp genes (TrpA � TrpE) are transcribed, but not translated. Which of the following features of the trp operon is likely least essential to the process of attenuation? A.The order of the structural genes,...

  • A. You are studying a strain of bacteria that carries a temperature-sensitive mutation in one of...

    A. You are studying a strain of bacteria that carries a temperature-sensitive mutation in one of the genes required for DNA replication. The bacteria grow normally at the lower temperature, but when the temperature is raised they die. When you analyze the remains of the bacterial cells grown at the higher temperature you find evidence of partly replicated DNA. When the strands of this DNA are separated by heating, numerous single-stranded DNA molecules around 1000 nucleotides long are found. Which...

  • 7. In bacteria the elongation stage of protein synthesis does not involve: A) aminoacyl-tRNAS B) EF-Tu...

    7. In bacteria the elongation stage of protein synthesis does not involve: A) aminoacyl-tRNAS B) EF-Tu C) GTP D) IF-2 E) peptidyl transferase Which of the following best describes the cholesterol molecule? A) Amphipathic B) Nonpolar, charged C) Nonpolar, uncharged D) Polar, charged E) Polar, uncharged The enzyme that attaches an amino acid to a tRNA (aminoacyl-tRNA synthetase): A) always recognizes only one specific tRNA. B) attaches a specific amino acid to any available tRNA species. C) attaches the amino...

  • Answer the questions: Question 1 Transcription begins at the..... a. operon o b. repressor c. genome...

    Answer the questions: Question 1 Transcription begins at the..... a. operon o b. repressor c. genome 17d. promoter Question 2 0.5 points Save RNA is synthesized on a DNA template in a process called replication, DNA polymerase translation, RNA polymerase transcription, RNA polymerise t ranscription, DNA polymerase Question 3 Which eukaryotic RNA polymerase makes tRNA's? a RNA polymerase IIIb. Any of these RNA polymerase I od RNA polymerase II A Moving to another question will save this response. Question 4...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT