


A. The single nucleotide substitution is substitution of a single base of a codon with a different base or nucleotide. In this case, the codon for the tryptophan amino acid (UGG) is changed due to a change a single nucleotide which may be the 2nd nucleotide. The G may have been substituted by A, which lead to UAG which is a stop codon. Thus, the Trp is changed to stop.
B. Generally, Trp operon is repressible operon, which means that when tryptophan is available the operon is repressed and the biosynthetic pathway is turned off.
Therefore in case of wild type E. coli, when the medium contains high levels of tryptophan, the operon is switched off. (a) There will be no stem loop structure in the regions 2 and 3 as this encodes anti-termination.
(b) The regions 3 and 4 will form a stem loop structure and transcription will be attenuated.
(c) Also, the expression if the Structural genes A-E will be turned off.
when the medium contains low levels of tryptophan, the operon is switched on as the tryptophan (an aporepressor ) is unable to bind to the repressor, threfore the operon is not turned off. (a) There will be a stem loop structure in the regions 2 and 3 as this encodes anti-termination.
(b) The regions 3 and 4 will not form a stem loop structure and there will be no transcription attenuation.
(c) Also, the expression if the Structural genes A-E will be turned on.
In case E. coli strain 401, contains a stop codon in the leader sequence, also it does not contain an aporepressor. So the polymerase will bind to the promoter , but the transcription of the leader sequence (region 1 ) won't be completed. This will lead to the stem loop structure of region 1 and 2 and pause the transcription.
(a) There will be no stem loop structure in the regions 2 and 3 as this encodes anti-termination.
(b) The regions 3 and 4 may form a stem loop structure and transcription will be attenuated.
(c) Also, the expression of the Structural genes A-E will be turned off.
C. In the presence of tryptophan, in case of 401/F' the A-E expression will be turned OFF , in case of strain 401, the A-E expression will be turned OFF ( since the polymerase is unable to move forward and cause transcription of the leader sequence), and in case of wild type, the A-E expression is turned OFF.
In the absence of tryptophan, in case of 401/F' the A-E expression will be turned ON , in case of strain 401, the A-E expression will be turned OFF, and in case of wild type, the A-E expression is turned ON.
D. If the strain 401 has wild type Trp leader sequence , but doesn't have a Trp aporepressor, the operon will be not be turned off and there will be expression of A-E. However, if it contains the wildtype aporepressor, then the operon will be swtiched off.
E. Eukaryotic genes are monocistronic and each has its own promoter, unlike the prokaryotic operons which is assemblage of many genes functioning under one promoter making them polycistronic. Hence, we do not expect to see such regulatory circuits in eukaryotes. In eukaryotes, attenuation doesn't occur. Instead to switch off the expression if a gene, mRNA silencing occurs.
3. Consider a hypothetical strain of E. coli (strain 401) that contains two mutations that affect...
consider a strain of E. coli that has a mutation in the gene encoding the IIA protein of the phosphotransferase system. The transport and phosphorylation of glucose is not affected by this mutation and the phosphate group is transferred to glucose as in the wildtype strain. Also, the interaction between the mutant IIA protein and Lacy is not affected by the mutation. However, the mutation does affect the IIA protein's interactions with adenylate cyclase and the phosphorylated form of the...
Trp Operon 5. The rate of transcription of the trp operon in E. coli is controlled by both repression and attenuation dr papde ia) Alternate secondary structures formed by the trpl tranecript Alternate 2 Regions 2 and 3 Atemate 1: Regions 1 and 2 basepared and regions 3 and 4 basepsired 54 140 Stop codon Transcribtion termination hairpin can NOT form a) Diagram and explain repression and attenuation regulatory mechanisms for the trp operon when tryptophan is present and absent....
UT EID: D. 5 E. 6 13. For the E. coli strain containing the following alleles of the lac operon, expression of lacZ and lacY is inducible, constitutively on or permanently repressed. (erepressor; r cannot bind operator: osoperator, o cannot bind repressor, lac are LOF mutations) A. lacZ is inducible, lacY is constitutively on. B. lacZ is constitutively on, lacY is inducible. C. lacZ is permanently repressed, lacY is constitutively on. D. lacZ is constitutively on, lacY is permanently repressed....
25. You take your lac/ strain and transform in two F' plasmids to conduct a complementation test. The first F' plasmid contains the entire lac operon from a strain that is lacz, while the second F' plasmid contains the entire lac operon from a strain that is lacY. You test the ability of the transformed bacteria to grow on media where the sole carbon source is either glucose or lactose, and obtain the following results: Lac t mutant compl lacZ...
You have a strain of E. coli which is ade- (adenine minus, meaning unable to make adenine on its own). In the biosynthesis of adenine, there are five steps as follows: In the biosynthetic pathway shown above, the ‘precursor’ is the starting material. Enzyme 1 converts this precursor to compound 1 (intermediate 1), enzyme 2 then acts on compound 1 to give rise to compound 2 (intermediate 2), so on and so forth, until enzyme 5 gives rise to the...
What would the most likely phenotype of an E. coli colony containing pUC18 (without an insert fragment) be if the following de novo mutations occurred early in the growth of a single cell into a colony on your plate (assuming plate contains X-gal, IPTG and Amp)? a. A frameshift mutation in the fifth codon lacZ gene in pUC18. b. A loss of the pUC18 plasmid. c. A deletion of bps at positions 19-25 of the ampicillin resistance gene open reading...
1. What transcript is produced from this gene?
5’ ATTGTGAGCAGGAAGAGAGT 3’
3’ TAACACTCGTCCTTCTCTCA 5’
A) 5’AUUGUGAGCAGGAAGAGAGU3’
B) 5’ACUCUCUUCCUGCUCACAAU3’
C) 5’UAACACUCGUCCUUCUCUCA3’
D) 5’UGAGAGAAGGACGAGUGUUA3’
2.If the anticodon is 5’CAU 3’, what codon on the mRNA will it
bind?
3.The lac operon is ON in which situation:
A) Low glucose low lactose
B) Low glucose high lactose
C) High glucose high lactose
D) High glucose low lactose
4.You have isolated an E. coli mutant that has a deletion of the
gene encoding the...
You
inoculate a strain of E. coli into a broth culture and allow it to
grow. The broth medium contains three sugars: glucose, lactose, and
maltose. The strain you are growing prefers lactose to maltose. You
measured the growth by doing a viable cell count and drew a growth
curve after calculating the number of CFU/ml over time. There was
an initial lag phase, followed by an exponential phase. There was a
second lag phase of approximately 30 minutes followed...
You inoculate a strain of E. coli into a broth culture and allow it to grow. The broth medium contains three sugars: glucose, lactose, and maltose. The strain you are growing prefers lactose to maltose. You measured the growth by doing a viable cell count and drew a growth curve after calculating the number of CFU/ml over time. There was an initial lag phase, followed by an exponential phase. There was a second lag phase of approximately 30 minutes followed...
The lac operon contains a DNA sequence known as the lac promoter (P or P+ for wild type; P– for mutant (RNA polymerase does not bind)) that serves as the RNA polymerase binding site. The lac operon also contains a DNA sequence known as the Lac operator (O or O+ for wild type; O– or Oc for mutant (lac repressor cannot bind)) which is the binding site for lac repressor. The lac repressor, a protein, is encoded by the lac...