1)
An abundance of tryptophan in E. coli, inhibit the expression trp-operon genes (stops the transcription). This mechanism is called repressible negative gene regulation.
Trp operon is a negative repressible feedback mechanism. The repressor for the trp operon is produced by the trpR gene situated upstream to the promoter. trpR gene is expressed continually at a low level. This produces monomer of repressor proteins, which are in inactive state.
When tryptophan is present, these monomers combine to form tetramers and combine with tryptophan, this cause a conformation (in the repressor) that allows the repressor to bind the operator. So it prevents the RNA polymerase to bind and transcribe the operon, so tryptophan is not produced from its precursor. When tryptophan is absent, the repressor is in its inactive conformation and cannot bind the operator, so transcription continues to produce tryptophan.
When the tryptophan levels are low, the O site (operator site) of the trp operon is not occupied by repressor protein; repressor proteins also not occupied by tryptophan due to low levels. This will activate transcription of the Trp operon.
Attenuator RNA has four short sequences 1-4, which can form 3 distinct secondary structures: 1-2, 2-3, or 3-4. Formation of 2-3 stem loop structure works as a antiterminator form, while 3-4 stem loop works as a terminator form.
Production of a protein from an mRNA sequence is known as translation. Ribosomes bind to mRNA, and recruit tRNA molecules bound with tRNA specific amino acids. These tRNA have anticodons that are complementary to codon sequence of mRNA. Ribosomes form peptides bonds between amino acids, thus forming a peptide protein sequence.
The adjoined picture below shows repression of trp-operon under high tryptophan concentration.

Thus, the correct option is (B) The 5 trp genes (TrpA -TrpE) are not transcribed.
2)
The feature the trp operon is likely least essential to the process of attenuation is the order of the structural genes, E, D, C, B, A. Thus, the correct option is (A).
Which of the following occurs as a result of an abundance of tryptophan in E. coli?...
V while translating the leader peptide of the tip operon the ribosome pauses on the tryptophan codons, then O RNA polymerase will stop transcription of the trp operon 02. genes for cell dormancy are induced 3. the entire trp operon will be transcribed into mRNA. .4 the only peptide from the trp operon that will be produced is the leader peptide
Trp Operon 5. The rate of transcription of the trp operon in E. coli is controlled by both repression and attenuation dr papde ia) Alternate secondary structures formed by the trpl tranecript Alternate 2 Regions 2 and 3 Atemate 1: Regions 1 and 2 basepared and regions 3 and 4 basepsired 54 140 Stop codon Transcribtion termination hairpin can NOT form a) Diagram and explain repression and attenuation regulatory mechanisms for the trp operon when tryptophan is present and absent....
Which of the following features of the trp operon is most essential to the process of attenuation independent of the repressor protein? The order of the structural genes, E, D, C, B, A Allosteric modifications as a result of tryptophan binding. The operator sequence (trpO) The ability of sequences within the leader mRNA to pair with one another and form stem-lopp structures
stion 4 of 8 Map Genetics: A Conceptual Approach Reading Quiz ieroe 6th Edition MHE/Freeman by Saplina Leary Use the information gathered in the Attenuation Animation to answer the following question. What effect on the expression of the trp operon might you expect if the stretch of T.A base pairs following region 4 were deleted? O The entire trp operon will be transcribed no matter what the level of tryptophan in the cell. The leader sequence of the trp operon...
3. Consider a hypothetical strain of E. coli (strain 401) that contains two mutations that affect tryptophan biosynthesis. The first mutation is a single nucleotide substitution that converts the second tandem Trp codon in region 1 of the Trp leader sequence into a stop codon (see slides 2-7 of Lecture 24 on iLearn) trp structural genes trpE trpD trpC trpB trpA PO Trp Leader Met-Lys-Ala-lle-Phe-Val-Leu-Lys-Gly-Trp-Trp-Arg-Thr Ser- Stop Assume that strain 401 also contains a mutation in the gene for the...
You are studying a mutant strain of bacteria in which the trp operon includes a mutation in region 1 of the 5'UTR. Whereas in the wildtype strain the affected codons code for "trp, in the mutant strain these codons code for "stop". How will this mutation affect attenuation? Translation of the S'UTR will stop at the position of the mutation in region 1. As a result, region 3 of the 5'UTR will pair with region 2 in the mRNA causing...
1. The terminating "hairpin" loop occurs in the tryptophan operon when ________. A. sufficient glucose is present. B. sufficient tryptophan is present. C. insufficient tryptophan is present. D. insufficient glucose is present. E. None of the above 2. When tryptophan is present in the medium and available to the bacterium, ________. A. the repressor is inactive and the tryptophan operon is "off" B. the repressor is inactive and the tryptophan operon is "on" C. the repressor is bound to the...
Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work to control the levels of Trpe peptide? What happens when tryptophan levels are high in the cell? When they are low? (drawings may be used to assist in your explanation)(B) Does this happen in eukaryotes, prokaryotes or both? Why? (6 pts) Leader peptide Met-Lys - Al-te-Phe Val- mRNA PPPAAGUUCACGUAAAAAGGGUAUCGACAAUGAAAGCAAUUUUCGUACUGA GUAGUA MARCGAAAUGCGUACCACUUAUGUGACGGGCAANGUCCUUCACGCGGUGGU stop)-Ser-Thr-Arg - Trp - Top- ACCCAGCCCGCCUAAUGAGCGGGCUUUUUUUUGAACAAAAUUAGAGAAUAAGAAUGCAAACA Met-Gin-The- Trpt polypeptide Site of transcription attenuation...
UT EID: D. 5 E. 6 13. For the E. coli strain containing the following alleles of the lac operon, expression of lacZ and lacY is inducible, constitutively on or permanently repressed. (erepressor; r cannot bind operator: osoperator, o cannot bind repressor, lac are LOF mutations) A. lacZ is inducible, lacY is constitutively on. B. lacZ is constitutively on, lacY is inducible. C. lacZ is permanently repressed, lacY is constitutively on. D. lacZ is constitutively on, lacY is permanently repressed....
Exam Practice Questions: L09-11 1. Fill in each blank with the best word or phrase selected from the list below. Not all words or phrases will be used; each word or phrase should be used only once. promoter translation pause site RBS sigma factor tmRNA RNA polymerase stop codon transcription Rho factor ribosome start codon DNA polymerase attenuation tRNA The first step in gene expression is by to make an mRNA that encodes for one or more proteins. This requires...