Question

V while translating the leader peptide of the tip operon the ribosome pauses on the tryptophan codons, then O RNA polymerase

0 0
Add a comment Improve this question Transcribed image text
Answer #1

leader peptides in the Trp operon are for the regulation of the Trp operon, there are 4 leader sequences if the Trp levels in the cell is low the Trp operon has to be expressed to synthesize Trp.

stem-loops can form between regions 2 and 3, and regions 3 and 4, if the stem-loop forms between 2 and 3, the transcription continues, if the stem loop forms between 3 and 4, the mRNA falls offf from the DNA, so transcription stops there.

In bacteria translation and transcription can occur simultaneously if the Trp is available in the cell, Ribosome translate the leader sequence 1 and 2 faster ( there are codons in the leader sequence 1 for Trp) s when sequence 3 is transcribed the region 2 is bound with the ribosome, so 2 and 3 cannot form stem-loop, so stem-loop forms between 3 and 4 regions so translation pauses there.

if the Trp is not available in the cell, then ribosome pauses at sequence 1, so 2 and 3 can form stem-loop, so transcription continues.

so the answer is 3) the entire Trp operon will be transcribed to mRNA.

Add a comment
Know the answer?
Add Answer to:
V while translating the leader peptide of the tip operon the ribosome pauses on the tryptophan...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Which of the following occurs as a result of an abundance of tryptophan in E. coli?...

    Which of the following occurs as a result of an abundance of tryptophan in E. coli? A.The leader sequence is not transcribed. B.The 5 trp genes (TrpA � TrpE) are not transcribed. C.Stalling of the ribosome at trp codons in the leader sequence D. The 5 trp genes (TrpA � TrpE) are transcribed, but not translated. Which of the following features of the trp operon is likely least essential to the process of attenuation? A.The order of the structural genes,...

  • Prepare two diagrams illustrating the tryptophan operon attenuation mechanism. One diagram should be for the condition...

    Prepare two diagrams illustrating the tryptophan operon attenuation mechanism. One diagram should be for the condition of low tryptophan concentration and the other for high tryptophan concentration. Write at least two sentences for each of the two diagrams that explains how attenuation allows bacteria to control the level of tryptophan. Provide the following labels on the diagrams to support your explanation: DNA, mRNA, polypeptide, RNA polymerase, ribosome, tryptophan codons, mRNA region #1, mRNA region #2, mRNA region #3, mRNA region...

  • Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work...

    Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work to control the levels of Trpe peptide? What happens when tryptophan levels are high in the cell? When they are low? (drawings may be used to assist in your explanation)(B) Does this happen in eukaryotes, prokaryotes or both? Why? (6 pts) Leader peptide Met-Lys - Al-te-Phe Val- mRNA PPPAAGUUCACGUAAAAAGGGUAUCGACAAUGAAAGCAAUUUUCGUACUGA GUAGUA MARCGAAAUGCGUACCACUUAUGUGACGGGCAANGUCCUUCACGCGGUGGU stop)-Ser-Thr-Arg - Trp - Top- ACCCAGCCCGCCUAAUGAGCGGGCUUUUUUUUGAACAAAAUUAGAGAAUAAGAAUGCAAACA Met-Gin-The- Trpt polypeptide Site of transcription attenuation...

  • Ok, let's now think about the circumstances under which attenuation would occur, vs. the scenario that...

    Ok, let's now think about the circumstances under which attenuation would occur, vs. the scenario that would promote read-through (i.e. attenuation does not occur). Describe what is happening in the figure below, and how this corresponds to levels of tryptophan in the .cell (2 pts). RNA polymerase DNA Completed MKAIFVLKG leader peptide MU096 Ribosome mRNA 5 Attenuator structure Trp codons

  • 42. Which is correct about the peptide elongation by ribosome? Select one: a. Addition of a...

    42. Which is correct about the peptide elongation by ribosome? Select one: a. Addition of a new amino acid is achieved by peptide transfer from the A site tRNA to the P site URNA. b. Translation is not affected by the cellular availability of GTP. O c. Peptide bond formation is catalyzed by enzymatic proteins in ribosome. O d. The peptide bond is formed by a nucleophilic attack of the A-site NH2- onto the P-site -COOH. O e. None of...

  • gene regulation of bacteria operon systems. Protected View . Saved to this PG References Mailings Review...

    gene regulation of bacteria operon systems. Protected View . Saved to this PG References Mailings Review View Help Tell me what you want to do ernet can contain viruses. Unless you need to edit, it's safe to stay in Protected View Enable Editing 5. What happens if lactose levels are low? Put the following list in order (1-5). RNA polymerase is blocked from transcribing the genes for the lactose metabolizing enzymes When RNA polymerase binds to the promoter, it cannot...

  • Exam Practice Questions: L09-11 1. Fill in each blank with the best word or phrase selected...

    Exam Practice Questions: L09-11 1. Fill in each blank with the best word or phrase selected from the list below. Not all words or phrases will be used; each word or phrase should be used only once. promoter translation pause site RBS sigma factor tmRNA RNA polymerase stop codon transcription Rho factor ribosome start codon DNA polymerase attenuation tRNA The first step in gene expression is by to make an mRNA that encodes for one or more proteins. This requires...

  • DNA polymerases are processed, which means that they remain tightly associated with the while moving rapidly...

    DNA polymerases are processed, which means that they remain tightly associated with the while moving rapidly and adding nucleotides to the growing daughter strand. Which piece of the machinery accounts for this characteristic? (a) helicase (b) sliding elamp (c) single-strand binding protein (d) primase RNA in cells differs from in that _____ (A) it contains the base uracil, which pairs with cytosine (b) it is single stranded and cannot form base pairs (c) it is single stranded and can fold...

  • Question 1 Match the term with the best definition or description; most topics relate to the...

    Question 1 Match the term with the best definition or description; most topics relate to the regulation of gene expression. General type of protein which will increase transcription rates when it attaches to a site A. Factor connected to a particular gene - B. Co-repressor C. Enhancer D. Promoter E. Structural F. Intron G. Activator H. Operator I. Basal transcription J. Glucocorticoid receptor K. Sigma factor L. Mediator M. Inducer N. TATA box O. Repressor The rates of mRNA produced...

  • choose the right answer : 1- what is degradation of ' unwanted' proteins in eukaryotic cells...

    choose the right answer : 1- what is degradation of ' unwanted' proteins in eukaryotic cells A- polyribosomes B- proteasomes C- editosome D- spliceosomes 2- addition or deletion of bases causes which kind of mutation A- transition B- transcription C- transversion D- frameshift mutation 3- point mutation involve : A- change in single base pair B- deletion C- duplication D- insertion 4- what is the complementary m-RNA sequence for the DNA sequence C-A-A-G-G-T A- C-A-A-G-G-U B- G-U-U-C-C-A C- C-A-A-G-G-T D-...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT