Question

Prepare two diagrams illustrating the tryptophan operon attenuation mechanism. One diagram should be for the condition...

Prepare two diagrams illustrating the tryptophan operon attenuation mechanism. One diagram should be for the condition of low tryptophan concentration and the other for high tryptophan concentration. Write at least two sentences for each of the two diagrams that explains how attenuation allows bacteria to control the level of tryptophan. Provide the following labels on the diagrams to support your explanation: DNA, mRNA, polypeptide, RNA polymerase, ribosome, tryptophan codons, mRNA region #1, mRNA region #2, mRNA region #3, mRNA region #4, termination stem-loop, ribosome stalling, termination of transcription, continuation of transcription, tryptophan-tRNA. (Do not consider the tryptophan repressor for this question)

0 0
Add a comment Improve this question Transcribed image text
Know the answer?
Add Answer to:
Prepare two diagrams illustrating the tryptophan operon attenuation mechanism. One diagram should be for the condition...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work...

    Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work to control the levels of Trpe peptide? What happens when tryptophan levels are high in the cell? When they are low? (drawings may be used to assist in your explanation)(B) Does this happen in eukaryotes, prokaryotes or both? Why? (6 pts) Leader peptide Met-Lys - Al-te-Phe Val- mRNA PPPAAGUUCACGUAAAAAGGGUAUCGACAAUGAAAGCAAUUUUCGUACUGA GUAGUA MARCGAAAUGCGUACCACUUAUGUGACGGGCAANGUCCUUCACGCGGUGGU stop)-Ser-Thr-Arg - Trp - Top- ACCCAGCCCGCCUAAUGAGCGGGCUUUUUUUUGAACAAAAUUAGAGAAUAAGAAUGCAAACA Met-Gin-The- Trpt polypeptide Site of transcription attenuation...

  • Trp Operon 5. The rate of transcription of the trp operon in E. coli is controlled by both repression and attenuation dr papde ia) Alternate secondary structures formed by the trpl tranecript Alterna...

    Trp Operon 5. The rate of transcription of the trp operon in E. coli is controlled by both repression and attenuation dr papde ia) Alternate secondary structures formed by the trpl tranecript Alternate 2 Regions 2 and 3 Atemate 1: Regions 1 and 2 basepared and regions 3 and 4 basepsired 54 140 Stop codon Transcribtion termination hairpin can NOT form a) Diagram and explain repression and attenuation regulatory mechanisms for the trp operon when tryptophan is present and absent....

  • 5. Which of the followin g is After the DNA unwinds only one strand acts as...

    5. Which of the followin g is After the DNA unwinds only one strand acts as a compliance The two strands only act as a plate when paired In prokaryotes the binding of RNAP the two strands After the DNA unwind hath DNA strands at templates occurs randomly on either of of RNA polymerase to unwound DNA Occurs 14. What is an anticodon? The three RNA behaal with nifie umino acid. The three RNA bases that air with a c...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT