for transcription to occur, the structure of DNA must be in A. Closed promoter complex B....
for transcription to occur, the structure of DNA must be in A. Closed promoter complex B. the biphasic promoter complex C. the open promoter complex D. none of the above E.All of the above
Homework Answers
Add Answer to:
for transcription to occur, the structure of DNA must be in A.
Closed promoter complex B....
Choose all that apply to the initiation of transcription Promoter segments Ribosome tRNA DNA polymerase Transcription...
Choose all that apply to the initiation of transcription Promoter segments Ribosome tRNA DNA polymerase Transcription factors Question 25 (4 points) Saved Choose all the molecules that are used in transcription: a) primase b) DNA c) nucleotides d) RNA polymerase e) SSB (single strand binding protein)
please explain a and b shkaryote 4. Transcription. The DNA below contains a promoter sequence recognized...
please explain a and b
shkaryote 4. Transcription. The DNA below contains a promoter sequence recognized by E. coli RNA polymerase (NAF) TOUCA s. 5'-AACGTAACTGAATTCCGCAATGGCATGGCATTGCTCATTATACTTAGTCTAATATGTCAA-3' 3'-TTGCATTGACTTAAGGCGTTACCGTACCGTAACGAGTAATATGAATCAGATTATACAGTI-5 A THAT A) Draw boxes around the two promoter elements, centered at - 10 and -35, relative to the start site of transcription. B) Transcription starts at the A-T base pair, which is indicated by the bold letters in the DNA shown above. Based on the asymmetric promoter sequence, RNAP selects one strand as...
32P-labeled promoter DNA was mixed, in various combinations, with the general transcription factors TFIID (D), TFIIA (A...
32P-labeled promoter DNA was mixed, in various combinations, with the general transcription factors TFIID (D), TFIIA (A), TFIIB (B), TFIIF (F), and RNA polymerase II (Pol II). Binding of these factors to the promoter DNA was autoradiograph of the gel is shown below. The anode (+ electrode) is at the bottom. Labels on top of each lane indicate the factors mixed with DNA. For binding reactions 3-7 (lanes 3-7), the concentration of RNA Pol II was continually increased from zero...
can someone help explain part b 4. Transcription. The DNA below contains a promoter sequence recognized...
can someone help explain part b
4. Transcription. The DNA below contains a promoter sequence recognized by E. coli RNA polymerase (KNAP): 5'-AACGTAACTGAATTCCGCAATGGCATGGCATTGCTCATTATACTTAGTCTAATATGTCAA-3 3'-TTGCATTGACTTAAGGCGTTACCGTACCGTAACGAGTAATATGAATCAGATTATACAGTT-5'. A) B) Draw boxes around the two promoter elements, centered at -10 and -35. relative to the start site of transcription Transcription starts at the A-T base pair, which is indicated by the bold letters in the DNA shown above. Based on the asymmetric promoter sequence, RNAP selects one strand as the template for RNA synthesis....
An experiment was conducted to determine the effects of a novel promoter on the transcription of a gene.
An experiment was conducted to determine the effects of a novel promoter on the transcription of a gene. The cloned promoter and coding regions were ligated to luciferase, a reporter gene. Several regions of DNA in the promoter region were deleted. Each construct was transformed into cells, and the luciferase activity was measured. The data from the experiment is listed in the table.Which conclusions can be drawn from the data?-Transcription increases when region A is deleted because the promoter region...
Which of the following is not involved in the formation of a eukaryotic transcription initiation complex?...
Which of the following is not involved in the formation of a eukaryotic transcription initiation complex? a. TATA box b. transcription factors c. snRNA d. promoter
8. In transcription, A) mRNA is synthesized from DNA B) the starting point of synthesis is...
8. In transcription, A) mRNA is synthesized from DNA B) the starting point of synthesis is the promoter site C) RNA polymerase binds to the promoter during initiation D) the ending point of synthesis is the terminator site E) All of the above The tryptophan (trp) operon is actively transcribed (i.e. gene expression occurs) A) when there is excess tryptophan in the cell. B) when there is a lack of tryptophan in the cell. C) constitutively because the trp operon...
Which of the following is the site for the start of transcription? a. Promoter b. Terminator...
Which of the following is the site for the start of transcription? a. Promoter b. Terminator c. Regulation sequences d. Transcription factors e. All of the answers may start transcription
In eukaryotic transcription what is the function of a chromatin remodeling complex? Chromatin remodeling complexes form...
In eukaryotic transcription what is the function of a chromatin remodeling complex? Chromatin remodeling complexes form nucleosome structures at protein-coding regions to lock genes from transcription when they are inactive. Chromatin remodeling complexes clear nucleosomes away from enhancer regions, so that transcription goes at full rate. Chromatin remodeling complexes reform DNA structure after transcription is complete to keep it stable . Chromatin remodeling complexes clear nucleosomes away from promoter regions, so that transcription initiation complexes can form and function.
Below is a diagram of a transcription unit and the mRNA made from the transcription unit:...
Below is a diagram of a transcription unit and the mRNA made from the transcription unit: A H TTGACA DNA TATAAT -35 B -10 С D - Start codon Stop codon mRNA 5' 3' E F G Is this a prokaryotic or eukaryotic transcription unit? prokaryotic What is the name of the cofactor required for RNA polymerase to bind to the promoter? Which letters on the above diagram correspond to the following structures? Promoter Pribnow box Non-template strand Transcriptional start...
Choose all that apply to the initiation of transcription Promoter segments Ribosome tRNA DNA polymerase Transcription factors Question 25 (4 points) Saved Choose all the molecules that are used in transcription: a) primase b) DNA c) nucleotides d) RNA polymerase e) SSB (single strand binding protein)
please explain a and b
shkaryote 4. Transcription. The DNA below contains a promoter sequence recognized by E. coli RNA polymerase (NAF) TOUCA s. 5'-AACGTAACTGAATTCCGCAATGGCATGGCATTGCTCATTATACTTAGTCTAATATGTCAA-3' 3'-TTGCATTGACTTAAGGCGTTACCGTACCGTAACGAGTAATATGAATCAGATTATACAGTI-5 A THAT A) Draw boxes around the two promoter elements, centered at - 10 and -35, relative to the start site of transcription. B) Transcription starts at the A-T base pair, which is indicated by the bold letters in the DNA shown above. Based on the asymmetric promoter sequence, RNAP selects one strand as...
32P-labeled promoter DNA was mixed, in various combinations, with the general transcription factors TFIID (D), TFIIA (A), TFIIB (B), TFIIF (F), and RNA polymerase II (Pol II). Binding of these factors to the promoter DNA was autoradiograph of the gel is shown below. The anode (+ electrode) is at the bottom. Labels on top of each lane indicate the factors mixed with DNA. For binding reactions 3-7 (lanes 3-7), the concentration of RNA Pol II was continually increased from zero...
can someone help explain part b
4. Transcription. The DNA below contains a promoter sequence recognized by E. coli RNA polymerase (KNAP): 5'-AACGTAACTGAATTCCGCAATGGCATGGCATTGCTCATTATACTTAGTCTAATATGTCAA-3 3'-TTGCATTGACTTAAGGCGTTACCGTACCGTAACGAGTAATATGAATCAGATTATACAGTT-5'. A) B) Draw boxes around the two promoter elements, centered at -10 and -35. relative to the start site of transcription Transcription starts at the A-T base pair, which is indicated by the bold letters in the DNA shown above. Based on the asymmetric promoter sequence, RNAP selects one strand as the template for RNA synthesis....
Below is a diagram of a transcription unit and the mRNA made from the transcription unit: A H TTGACA DNA TATAAT -35 B -10 С D - Start codon Stop codon mRNA 5' 3' E F G Is this a prokaryotic or eukaryotic transcription unit? prokaryotic What is the name of the cofactor required for RNA polymerase to bind to the promoter? Which letters on the above diagram correspond to the following structures? Promoter Pribnow box Non-template strand Transcriptional start...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 11 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 11 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 11 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 11 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 11 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 11 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 11 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 11 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 11 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 11 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 11 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 11 months ago