Homework Answers
DNA-------mRNA----tRNA----amino acid
1.TTG-----AAC-------UUG-----Asn
2.CGT-----GCA-------CGU-----Ala
3.GCA-----CGU-------GCA-----Arg
4.ACC-----UGG-------ACC-----Trp
5.ACA-----UGU--------ACA-----Cys
6.CTT------GAA--------CUU-----Glu
7.AGT------UCA--------AGU-----Ser
8.TAC------AUG--------UAC-----Met
Explanation
mRNA is complementary to template strand of DNA.
T--> A
A--> U
C--> G
G--> C
tRNA sequence is complementary to mRNA
U-->A
A--> U
C--> G
G--> C
amino acid corresponds to triplet codon present in mRNA.
Add Answer to:
h Select Add Paragraph . ::. 1:23 1.4 Styles 5 Editing 6 ... 7... Complete the...
Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following...
Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following table that relates the sequences of DNA, mRNA, RNA, and the resulting polypeptide. DNA informational strand: 5' end 3' end Guide DNA template strand: 3' end GTC CCC GCG GGG ACG TTG 5' end mRNA codons: 5' end 5' end 0 0 3'end 3' end tRNA anticodons: Polypeptide: TABLE 22.3 The Genetic Code - Triplets in Messenger RNA First Base (5 end) Second Base...
If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give...
If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (c) Give the amino acid sequence. (1.5 marks) You will require the following genetic code to answer this question. Second letter с...
21-1114 Date Transcription Kit Checklist Part 1: Making mRNA 1. Parts of a nucleotide: Approved Sugar...
21-1114 Date Transcription Kit Checklist Part 1: Making mRNA 1. Parts of a nucleotide: Approved Sugar Phosphate Bases: Adenine Guanine Cytosine Uracil 2. One nucleotide Note: Omit 3-6 if not using the DNA Structure and Function Kit. 3. Separated DNA 4. Template DNA with one complementary nucleotide of RNA hydrogen bonded 5. Template DNA with strand of mRNA hydrogen bonded 6. Separated mRNA and duplex DNA molecule 7. Completed mRNA with cap and tail 8. The cap 9. The tail...
A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’. Using the...
A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’.
Using the codon chart provided, answer the following
questions:
-What is the sequence of amino acids that is produced when this
gene is translated?
-If a mutation causes a substitution (an A instead of a T) 3’
CCA AGC ACT 5’, what effect will it have on the mRNA transcript AND
on the protein?
-What do we call this type of mutation?
Second letter U С...
To Do Exit 1:00:32 41697 m 2 1:59 PN 68. -33761 5 Que at 11:5 1.5...
To Do Exit 1:00:32 41697 m 2 1:59 PN 68. -33761 5 Que at 11:5 1.5 pts 68a. Transcribe the mRNA molecule resulting from the following template DNA 33761 GTC-TAC-GCA-CTT-GGT-GCT-AGC-CTA-ACT-GAA-TCC 3761 - April Enter answer... -761 69. I 11 Second base of RNA codon +63 UUU UUC UGU _ Phenylalanine Phel VUA Serine Ser) UU LAC UAA UAG Tyrosine (Tyr) Stop Stop UUG Leul COU CAU UGC UGA Stop UGG Tryptophan (Top) CGU CGC Arginine CGA CGG Histidine CACH Proline...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 -...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
5 pts Question 23 Life on Earth uses 3 nucleotide long code words, with 4 letters...
5 pts Question 23 Life on Earth uses 3 nucleotide long code words, with 4 letters in the alphabet to encode 20 amino acids. DNA on the planet Arth only contains A, G and C. In addition, proteins on Arth are made from 26 different amino acids. What is the minimum number of nucleotides in a codon needed to code for life on Arth? Hint: In humans a 3-letter code can represent 4 x 4 x4 = 64 amino acids...
Please answer number 21-25, explain and clearly indicate which number you are answering. Thanks in advance!...
Please answer number 21-25, explain and clearly indicate
which number you are answering. Thanks in advance!
(Q21-25) We have the following double-stranded
DNA sequences, which codes for a 10 amino acid long protein gene.
Use the codon table and answer the questions.
5'-CCTGTGTCACTCACAGGGGATGGTATCACAGTGAGTCATGGGTTT-3'
3'-GGACACAGTGAGTGTCCCCTACCATAGTGTCACTCAGTACCCAAA-5'
21. Which strand codes for this protein?
A. top
B. bottom
C. both strands
D. none of the above
22. If this is a eukaryotic gene, which RNA polymerase
will make mRNA?
A. RNA Pol I...
C++ Help Task B: Translation While a nucleotide is the basic unit of information, three nucleotid...
C++ Help
Task B: Translation
While
a nucleotide is the basic unit of information, three nucleotides,
or codon, is the basic unit of storage. The reason
for this is that each gene codes for a protein, and all proteins
are made from 20 amino acids. Recall that there are 4 different
bases that make up dna. Thus, three bases can encode for 4x4x4 = 64
different symbols. Two base pairs can only encode for 4x4 = 16
symbols, which is...
all please Question 2 (1 point) ✓ Saved In Drosophila, the mutant black (b) has a...
all please
Question 2 (1 point) ✓ Saved In Drosophila, the mutant black (b) has a black body and the wild-type (b+) has a gray body; the mutant vestigial (v) has wings that are short and crumpled compared the long wild-type wings (v+). These genes are linked and are located on the X- chromosome. A cross between a female fly and a black, vestigial winged male fly produced the following progeny: gray (b+), normal (v+) 20 gray (b+), vestigial (v)...
Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following table that relates the sequences of DNA, mRNA, RNA, and the resulting polypeptide. DNA informational strand: 5' end 3' end Guide DNA template strand: 3' end GTC CCC GCG GGG ACG TTG 5' end mRNA codons: 5' end 5' end 0 0 3'end 3' end tRNA anticodons: Polypeptide: TABLE 22.3 The Genetic Code - Triplets in Messenger RNA First Base (5 end) Second Base...
If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (c) Give the amino acid sequence. (1.5 marks) You will require the following genetic code to answer this question. Second letter с...
21-1114 Date Transcription Kit Checklist Part 1: Making mRNA 1. Parts of a nucleotide: Approved Sugar Phosphate Bases: Adenine Guanine Cytosine Uracil 2. One nucleotide Note: Omit 3-6 if not using the DNA Structure and Function Kit. 3. Separated DNA 4. Template DNA with one complementary nucleotide of RNA hydrogen bonded 5. Template DNA with strand of mRNA hydrogen bonded 6. Separated mRNA and duplex DNA molecule 7. Completed mRNA with cap and tail 8. The cap 9. The tail...
A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’.
Using the codon chart provided, answer the following
questions:
-What is the sequence of amino acids that is produced when this
gene is translated?
-If a mutation causes a substitution (an A instead of a T) 3’
CCA AGC ACT 5’, what effect will it have on the mRNA transcript AND
on the protein?
-What do we call this type of mutation?
Second letter U С...
To Do Exit 1:00:32 41697 m 2 1:59 PN 68. -33761 5 Que at 11:5 1.5 pts 68a. Transcribe the mRNA molecule resulting from the following template DNA 33761 GTC-TAC-GCA-CTT-GGT-GCT-AGC-CTA-ACT-GAA-TCC 3761 - April Enter answer... -761 69. I 11 Second base of RNA codon +63 UUU UUC UGU _ Phenylalanine Phel VUA Serine Ser) UU LAC UAA UAG Tyrosine (Tyr) Stop Stop UUG Leul COU CAU UGC UGA Stop UGG Tryptophan (Top) CGU CGC Arginine CGA CGG Histidine CACH Proline...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
5 pts Question 23 Life on Earth uses 3 nucleotide long code words, with 4 letters in the alphabet to encode 20 amino acids. DNA on the planet Arth only contains A, G and C. In addition, proteins on Arth are made from 26 different amino acids. What is the minimum number of nucleotides in a codon needed to code for life on Arth? Hint: In humans a 3-letter code can represent 4 x 4 x4 = 64 amino acids...
Please answer number 21-25, explain and clearly indicate
which number you are answering. Thanks in advance!
(Q21-25) We have the following double-stranded
DNA sequences, which codes for a 10 amino acid long protein gene.
Use the codon table and answer the questions.
5'-CCTGTGTCACTCACAGGGGATGGTATCACAGTGAGTCATGGGTTT-3'
3'-GGACACAGTGAGTGTCCCCTACCATAGTGTCACTCAGTACCCAAA-5'
21. Which strand codes for this protein?
A. top
B. bottom
C. both strands
D. none of the above
22. If this is a eukaryotic gene, which RNA polymerase
will make mRNA?
A. RNA Pol I...
C++ Help
Task B: Translation
While
a nucleotide is the basic unit of information, three nucleotides,
or codon, is the basic unit of storage. The reason
for this is that each gene codes for a protein, and all proteins
are made from 20 amino acids. Recall that there are 4 different
bases that make up dna. Thus, three bases can encode for 4x4x4 = 64
different symbols. Two base pairs can only encode for 4x4 = 16
symbols, which is...
all please
Question 2 (1 point) ✓ Saved In Drosophila, the mutant black (b) has a black body and the wild-type (b+) has a gray body; the mutant vestigial (v) has wings that are short and crumpled compared the long wild-type wings (v+). These genes are linked and are located on the X- chromosome. A cross between a female fly and a black, vestigial winged male fly produced the following progeny: gray (b+), normal (v+) 20 gray (b+), vestigial (v)...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 11 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 11 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 11 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 11 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 11 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 11 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 11 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 11 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 11 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 11 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 11 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 11 months ago