Question

h Select Add Paragraph . ::. 1:23 1.4 Styles 5 Editing 6 ... 7... Complete the following table with the missing pieces. (2 po

0 0
Add a comment Improve this question Transcribed image text
Answer #1

DNA-------mRNA----tRNA----amino acid

1.TTG-----AAC-------UUG-----Asn

2.CGT-----GCA-------CGU-----Ala

3.GCA-----CGU-------GCA-----Arg

4.ACC-----UGG-------ACC-----Trp

5.ACA-----UGU--------ACA-----Cys

6.CTT------GAA--------CUU-----Glu

7.AGT------UCA--------AGU-----Ser

8.TAC------AUG--------UAC-----Met

Explanation

mRNA is complementary to template strand of DNA.

T--> A

A--> U

C--> G

G--> C

tRNA sequence is complementary to mRNA

U-->A

A--> U

C--> G

G--> C

amino acid corresponds to triplet codon present in mRNA.

Add a comment
Know the answer?
Add Answer to:
h Select Add Paragraph . ::. 1:23 1.4 Styles 5 Editing 6 ... 7... Complete the...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following...

    Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following table that relates the sequences of DNA, mRNA, RNA, and the resulting polypeptide. DNA informational strand: 5' end 3' end Guide DNA template strand: 3' end GTC CCC GCG GGG ACG TTG 5' end mRNA codons: 5' end 5' end 0 0 3'end 3' end tRNA anticodons: Polypeptide: TABLE 22.3 The Genetic Code - Triplets in Messenger RNA First Base (5 end) Second Base...

  • If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give...

    If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (c) Give the amino acid sequence. (1.5 marks) You will require the following genetic code to answer this question. Second letter с...

  • 21-1114 Date Transcription Kit Checklist Part 1: Making mRNA 1. Parts of a nucleotide: Approved Sugar...

    21-1114 Date Transcription Kit Checklist Part 1: Making mRNA 1. Parts of a nucleotide: Approved Sugar Phosphate Bases: Adenine Guanine Cytosine Uracil 2. One nucleotide Note: Omit 3-6 if not using the DNA Structure and Function Kit. 3. Separated DNA 4. Template DNA with one complementary nucleotide of RNA hydrogen bonded 5. Template DNA with strand of mRNA hydrogen bonded 6. Separated mRNA and duplex DNA molecule 7. Completed mRNA with cap and tail 8. The cap 9. The tail...

  • A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’. Using the...

    A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’. Using the codon chart provided, answer the following questions: -What is the sequence of amino acids that is produced when this gene is translated? -If a mutation causes a substitution (an A instead of a T) 3’ CCA AGC ACT 5’, what effect will it have on the mRNA transcript AND on the protein? -What do we call this type of mutation? Second letter U С...

  • To Do Exit 1:00:32 41697 m 2 1:59 PN 68. -33761 5 Que at 11:5 1.5...

    To Do Exit 1:00:32 41697 m 2 1:59 PN 68. -33761 5 Que at 11:5 1.5 pts 68a. Transcribe the mRNA molecule resulting from the following template DNA 33761 GTC-TAC-GCA-CTT-GGT-GCT-AGC-CTA-ACT-GAA-TCC 3761 - April Enter answer... -761 69. I 11 Second base of RNA codon +63 UUU UUC UGU _ Phenylalanine Phel VUA Serine Ser) UU LAC UAA UAG Tyrosine (Tyr) Stop Stop UUG Leul COU CAU UGC UGA Stop UGG Tryptophan (Top) CGU CGC Arginine CGA CGG Histidine CACH Proline...

  • Question 10 (15 points) Given the following sequence for a template strand of DNA 3 -...

    Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...

  • 5 pts Question 23 Life on Earth uses 3 nucleotide long code words, with 4 letters...

    5 pts Question 23 Life on Earth uses 3 nucleotide long code words, with 4 letters in the alphabet to encode 20 amino acids. DNA on the planet Arth only contains A, G and C. In addition, proteins on Arth are made from 26 different amino acids. What is the minimum number of nucleotides in a codon needed to code for life on Arth? Hint: In humans a 3-letter code can represent 4 x 4 x4 = 64 amino acids...

  • Please answer number 21-25, explain and clearly indicate which number you are answering. Thanks in advance!...

    Please answer number 21-25, explain and clearly indicate which number you are answering. Thanks in advance! (Q21-25) We have the following double-stranded DNA sequences, which codes for a 10 amino acid long protein gene. Use the codon table and answer the questions. 5'-CCTGTGTCACTCACAGGGGATGGTATCACAGTGAGTCATGGGTTT-3' 3'-GGACACAGTGAGTGTCCCCTACCATAGTGTCACTCAGTACCCAAA-5' 21. Which strand codes for this protein? A. top B. bottom C. both strands D. none of the above 22. If this is a eukaryotic gene, which RNA polymerase will make mRNA? A. RNA Pol I...

  • C++ Help Task B: Translation While a nucleotide is the basic unit of information, three nucleotid...

    C++ Help Task B: Translation While a nucleotide is the basic unit of information, three nucleotides, or codon, is the basic unit of storage. The reason for this is that each gene codes for a protein, and all proteins are made from 20 amino acids. Recall that there are 4 different bases that make up dna. Thus, three bases can encode for 4x4x4 = 64 different symbols. Two base pairs can only encode for 4x4 = 16 symbols, which is...

  • all please Question 2 (1 point) ✓ Saved In Drosophila, the mutant black (b) has a...

    all please Question 2 (1 point) ✓ Saved In Drosophila, the mutant black (b) has a black body and the wild-type (b+) has a gray body; the mutant vestigial (v) has wings that are short and crumpled compared the long wild-type wings (v+). These genes are linked and are located on the X- chromosome. A cross between a female fly and a black, vestigial winged male fly produced the following progeny: gray (b+), normal (v+) 20 gray (b+), vestigial (v)...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT