Question

Actual gels dont have labels. Here, the labels have been removed, but the ladder remains the same as in the previous example

0 0
Add a comment Improve this question Transcribed image text
Answer #1

6.Here, from the gel results, Lane 1 refers to DNA marker/ ladder. In this gel 100 bp ladder has been used. The appropriate sizes of the band is as given below:

LANEI: MARKER SAMPLE DNA ILANE 2 LANE 3: LANE 4 LANE 5 da 1517 - 1200+ 1000+ 890 bp 900 da oot 620 bp 500 + 460 bp 4004 300€

7. Answer is: Lane 4, contains the same sample DNA from lane 2 after it was cut into two pieces.

The reason is:

Lane 2 DNA shows band at 700 bp , and when it has been digested with a restriction enzyme , which cuts at a specific site obviously produces two fragments. The length of these two fragments when summed up together should produce the length of the original DNA as in lane 2 (700 bp).

Lane 3,4 and 5 produces two fragments , hence the resstion digestion/ cut is at only single point leading to two fragments. Hence,

Lane 3:  230 bp + 620 bp = 850 bp

Lane 4: 240 bp+ 460 bp= 700 bp

Lane 5: 50 bp + 890 bp = 940 bp.

Hence lane 4 contains the same sample DNA from lane 2.

Add a comment
Know the answer?
Add Answer to:
Actual gels don't have labels. Here, the labels have been removed, but the ladder remains the...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • You are given a circular DNA molecule to analyze that is 3,000bp (3 Kb) long. You...

    You are given a circular DNA molecule to analyze that is 3,000bp (3 Kb) long. You proceed to treat the DNA molecule with different cutting enzymes and then you run the individual reactions on a gel. The following gel is produced with each column representing a different reaction (lane). In lane 1 a molecule weight ladder is run. In lane 2, the circular DNA is NOT treated with any enzyme. In lane 3 the DNA is treated with an enzyme...

  • Luestion 3 1 pts Review: You have the DNA that is radioactively labeled at the S'ends...

    Luestion 3 1 pts Review: You have the DNA that is radioactively labeled at the S'ends of DNA as shown below. But you want DNA that is labeled only at one end of the DNA, not both ends. One of the other undergraduate students in the lab suggests that you use a restriction enzyme to cut the DNA, then electrophorese the DNA in an agarose gel, then cut out the region of the gel with radioactive DNA fragment you want,...

  • 1) Imagine that you had two restriction enzymes and a known segment of linear DNA 160...

    1) Imagine that you had two restriction enzymes and a known segment of linear DNA 160 kb long: Enzyme A cuts at location(s): 20 kb, 45 kb 70 kb and 110 kb. Enzyme B cuts at location(s): 15 kb and 140 kb. Based on this information, first construct a linear map of this DNA showing the positions of these restriction enzyme cut sites. In the space below.draw what the gel would look like given the following lanes: (8 points total)...

  • I need the answers for questions 2 and 3. My DNA ladder is in lane 2...

    I need the answers for questions 2 and 3. My DNA ladder is in lane 2 marked by the yellow arrow. Thanks! Here is the only other info I have. Thanks! Part 2: Gel purification and on Gel Slice and PCR Product Preparin modified from TBSci.com instructions for gaan A. Dissolving the Gel Stie Following electrophores, eral DNA band from grand place glice microcentrifuge tube Ib. Use an analytical balance to weigh pelice Rec die 2. Add 500 balance to...

  • The PCR was a success and your target region of 770 bp in length has been...

    The PCR was a success and your target region of 770 bp in length has been amplified. You now plan to digest the DNA amplicon with the restriction enzyme Eael, and clone the resulting longest fragment it into the Eael site of the 5 kb plasmid diagrammed below. 770 bp BamHI 1 200 EcoRI 800 EcoRI 4000 1000 5 kb O /1000 2000 2000 Faal You purify your recombinant plasmid from bacterial cells, and run the plasmid (uncut. or not...

  • One strand of a DNA sequences is given below. Find the EcoRI sites and indicate the...

    One strand of a DNA sequences is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...

  • RESTRICTION DIGEST ANALYSIS QUESTIONS(true or yes = A: false or no = b) 1. Larger DNA...

    RESTRICTION DIGEST ANALYSIS QUESTIONS(true or yes = A: false or no = b) 1. Larger DNA fragments appear near the bottom of the gel. 2. Larger DNA fragments move more rapidly through the gel. D ONA that has many restriction sites for a certain endonuclease will be cut into more fragmets than DNA with fewer restriction sites. 4. Cutting DNA with many different endonucleases will result in more DNA fragments. 5. Restriction enzymes all recognize the same base sequence when...

  • You have accidentally torn the labels off two tubes, each containing a different plasmid, and now...

    You have accidentally torn the labels off two tubes, each containing a different plasmid, and now do not know which plasmid is in which tube. Fortunately, you have restriction maps for both plasmids, shown in the figure below. You have the opportunity to test just one sample from one of your tubes. You have equipment for agarose-gel electrophoresis, a standard set of DNA size markers, and the necessary restriction enzymes. A)Why won’t making a single cut (e.g. with HindIII) help...

  • Hi I have a problem with number 5, it involves gel analysis results. There are 2 parts, a,b,c. For A Im sure you need to make a graph with distance in (cm) on the vertical axis and log10 bp on the hor...

    Hi I have a problem with number 5, it involves gel analysis results. There are 2 parts, a,b,c. For A Im sure you need to make a graph with distance in (cm) on the vertical axis and log10 bp on the horitzontal. I need help figuring out where to start and what to do. Please help! The following question will provide practice in interpreting and analyzing gel results You obtained the DNA electrophoresis gel below. Three samples of lambda phage...

  • While your gel is running, discuss your expected results for each lane on the gel •...

    While your gel is running, discuss your expected results for each lane on the gel • Remove the gel from the apparatus and image on a UV transilluminator. (Remember to only illuminate the UV light when the shield is in place). 3) Using the DNA ladder, estimate the experimental size of all bands observed in the sample lanes. (3pt) Gel Lane Plasmid Number of bands observed Estimated size (bp) of each band 2 (tube 1) A 3 (tube 2) B...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT