Question

13. a. (2pt) If the amino acid shown were used to charge a tRNA molecule, circle the amino acid functional group that would be involved in this process CH2 CH2 NH2 b. (4pts) Aminoacyl tRNA synthetases form the functional group circle on the amino acid above and statement. (Make certain to specify functional group or structural region.) (type of bond) betweern complete c. (4pts) The amino acid shown above should be used to charge a tRNA with the anti-codon sequence (fill appropriate bubble) O C-A-A O G-U-U O U-U-G O U-A-A O U-U-A O A-A-C O A-A-U ○ G-U-G
0 0
Add a comment Improve this question Transcribed image text
Answer #1

to t-NA -LNA moleule

Add a comment
Know the answer?
Add Answer to:
13. a. (2pt) If the amino acid shown were used to "charge" a tRNA molecule, circle...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Associated Amino Acid: Compare your mRNA codon and tRNA anticodon with the amino acid chart provided....

    Associated Amino Acid: Compare your mRNA codon and tRNA anticodon with the amino acid chart provided. Determine which amino acid is coded for and write its name next to the corresponding number below. ① START - methionine ⑤Click or tap here to enter text. ②Click or tap here to enter text. ⑥Click or tap here to enter text. ③Click or tap here to enter text. ⑦Click or tap here to enter text. ④Click or tap here to enter text. ⑧Click...

  • Complete the following table and answer the next two questions (3.5 marts) 10 B I =...

    Complete the following table and answer the next two questions (3.5 marts) 10 B I = U Ꭶ X2 x E I 19 эс ✓ C Finis DNA strand G C А DNA strand TAC TAC mRNA codon AUG C G G tRNA anticodon G - Amino acid Tryptophan Stop mRNA and tRNA are involved in producing proteins from genes in the DNA. One codon consisting of 3 nucleotides corresponds to an amino acid in the protein that gets built...

  • Name_Rachel A Date TITILLEELELE PROTEINSI Questions 1. Which amino acids used in this experiment have acidic...

    Name_Rachel A Date TITILLEELELE PROTEINSI Questions 1. Which amino acids used in this experiment have acidic R-groups, which have basic R-groups, and which have neutral R-groups? Write acidic", "basic" or "neutral next to each amino acid below. • Glycine: • Glutamic acid: • Arginine: • Tyrosine: 1. Circle all the charged carboxyl groups (carboxylate groups) in the amino acid structures below. | HN-CH-- HN-CH-C-ộ HN-CH-C ó Glycine (Gly) Glutamic acid or glutamate (Glu) C=NH2 NH2 Arginine (Arg) UUUUU Proteins Chemistry...

  • What is the classification of the side chain R group in the amino acid shown here?...

    What is the classification of the side chain R group in the amino acid shown here? O A) acidic HN-CH-C-0 CH2 B) basic HN C) neutral -NH

  • i) Which statement about the biosynthesis of proteins is NOT correct? tRNA molecules function as carriers...

    i) Which statement about the biosynthesis of proteins is NOT correct? tRNA molecules function as carriers of the amino acids for protein biosynthesis. The growing peptide chain results from a nucleophilic addition-elimination reaction by an amino group at an ester group. A codon is a three-base sequence in mRNA that is specific for a particular amino acid. The biosynthesis of proteins is called transcription. ii) Which of the following does not occur during pyrosequencing? A 3'-OH attacks the α-phosphorus of...

  • 1. What amino acids do the following abbreviations stand for? Draw the structure of each. a)...

    1. What amino acids do the following abbreviations stand for? Draw the structure of each. a) lle b) Thr c) Gin 2. Name and draw the structures of the amino acids that fit these descriptions: a) Contains an isopropyl group b) Contains a secondary alcohol group 3. Which of the following objects is chiral? a) A pair of scissors b) A comb c) A drinking glass 4. What does the term achiral mean? Give two examples involving organic structures.. 5....

  • 1. An amino acid is shown below. Draw a circle around the carboxylic acid group, a square around the side chain and...

    1. An amino acid is shown below. Draw a circle around the carboxylic acid group, a square around the side chain and a triangle around the amino group. Finally, put an asterisk next to the C-carbon. HC=0 -C-C-H HNH3+ 2. Consider the molecule below (C&H BINO). After downloading Imol and the molecule files to your computer, measure the values of the indicated bond and torsional angles. CCN HOC = HO 1 OCCC - OCCBr =

  • Identify the structural components of an amino acid and understand the chemical diversity of amino acids...

    Identify the structural components of an amino acid and understand the chemical diversity of amino acids Question Coo- Anch H₂N-CH2 H2C CH Proline Proline's structure has a unique feature not found in other amino acids. What is it? Select the correct answer below: O Proline is chiral. O The amino group is part of the side chain. O Proline is positively charged. O Proline is achiral. P FEEDBACK MORE INSTRUCTION SUBMIT Content attribution Understand protonation and deprotonation of carboxyl and...

  • Genetics! help please May S Tae suumissis hot be accepted. 1. (10 points) A series of...

    Genetics! help please May S Tae suumissis hot be accepted. 1. (10 points) A series of tRNAs have the anticodon sequences shown below Considering wobble, use Figure 13.12 to determine the possible codons with which each tRNA could pair Posible codons (Indicate the s end of each codon) Anticodon sequence 5-ACG-3 5'-xm UmGG-3 5'-IGA-3' Indicate which amino acid would be covalently bonded to tRNAs with the anticodon sequences given above. Use Table 13.1 to help you with your answer. Anticodon...

  • 2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the...

    2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT