Question

What is the role of the protein encoded by the lacZ gene? The lacZ gene encodes an enzyme that converts lactose to allolactose, and the lacZ gene O O O O encodes an enzyme that converts lactose to glucose and galactose. The lacZ gene encodes an enzyme that permits lactose to enter the bacterial cell. The lacZ gene encodes an enzyme that converts lactose to glucose and galactose. All of the choices are true. The lacZ gene encodes an enzyme that converts lactose to allolactose.What is the role of the protein encoded by the lacZ gene?

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Ans:

The lacZ gene encodes an enzyme that converts lactose to allolactose, and the lacZ gene encodes an enzyme that converts lactose to glucose and galactose.

In lac operon, lacZ genes encodes for the enzyme B- galactosidase.

This enzyme can:

  • Convert lactose to allolactose.
  • Convert lactose into Glucose and galactose.
Add a comment
Know the answer?
Add Answer to:
What is the role of the protein encoded by the lacZ gene? What is the role...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 3. (2 points) In the nematode roundworm, Caenorhabditis elegans, the LIN-14 protein controls the timing of...

    3. (2 points) In the nematode roundworm, Caenorhabditis elegans, the LIN-14 protein controls the timing of certain cell divisions during development. LIN-14 protein levels are normally high in early development but decrease in the later stages. In a lin-4 mutant, the level of LIN-14 protein stays high throughout development, changing the pattern of cell divisions in the animal and producing defects in the shape of the animal. The lin-4 gene encodes a microRNA that binds to a sequence in the...

  • Match the protein listed below with the gene that encodes it or with the DNA sequence...

    Match the protein listed below with the gene that encodes it or with the DNA sequence within the lac operon where it binds: lac repressor (encoded by...) [Choose] lac repressor (where it binds...) [Choose ] B-galactosidase [Choose] Lactose permease [Choose] Galactoside transacetylase [Choose] CAP [Choose] lacz lacy lacl Operator CAP site lacA

  • 1. What transcript is produced from this gene? 5’ ATTGTGAGCAGGAAGAGAGT 3’ 3’ TAACACTCGTCCTTCTCTCA 5’ A) 5’AUUGUGAGCAGGAAGAGAGU3’...

    1. What transcript is produced from this gene? 5’ ATTGTGAGCAGGAAGAGAGT 3’ 3’ TAACACTCGTCCTTCTCTCA 5’ A) 5’AUUGUGAGCAGGAAGAGAGU3’ B) 5’ACUCUCUUCCUGCUCACAAU3’ C) 5’UAACACUCGUCCUUCUCUCA3’ D) 5’UGAGAGAAGGACGAGUGUUA3’ 2.If the anticodon is 5’CAU 3’, what codon on the mRNA will it bind? 3.The lac operon is ON in which situation: A) Low glucose low lactose B) Low glucose high lactose C) High glucose high lactose D) High glucose low lactose 4.You have isolated an E. coli mutant that has a deletion of the gene encoding the...

  • Background: Several genetic regions are needed for lactose metabolism: P(promoter), O(operator), lacZ(b-galactosidase gene), lacY(permease gene), lacA(transacetylase...

    Background: Several genetic regions are needed for lactose metabolism: P(promoter), O(operator), lacZ(b-galactosidase gene), lacY(permease gene), lacA(transacetylase gene) and lacI(repressor gene). Strains can be defined as having + - c or s copies: + refers to the functional version, - refers to a defect version, c refers to a constitutively active version and s refers to a superrepressor version. Each strain may or may not have an extra-chromosomal plasmid containing the genes indicated. TA=transacetylase it would be very helpful if you...

  • For the gene BRCA2, identify the normal function of the protein encoded by the gene and...

    For the gene BRCA2, identify the normal function of the protein encoded by the gene and how the mutations of the gene causes Breast cancer via the role of the defective protein in the gene. Diagrams are appreciated to demonstrate the following concepts; 1) Signal Transduction - Is it paracrine signalling? I actually don't understand how the kinases work. 2) Cell Division- It is the S phase right but like I don't know how to phrase it 3) Genetics -...

  • pls give short answers Q15 8 Points In C. elegans, a protein encoded by the gene...

    pls give short answers Q15 8 Points In C. elegans, a protein encoded by the gene odr-4 is required to transport the protein ODR-10 to the cell membrane of the worms' sensory neurons. As described in HW7, ODR-10 detects the molecule diacetyl, which is secreted by the worms' bacterial food source. What would happen to the animals' ability to detect diacetyl if there was a mutation in the odr-4 gene that inactivated it? (One sentence) Why (one sentence)? Enter your...

  • Lactose (or rather, its derivative allolactose) can lift the Lac Repressor protein from the Operator site...

    Lactose (or rather, its derivative allolactose) can lift the Lac Repressor protein from the Operator site in DNA, thus allowing for expression of the genes coded by the Lac Operon. However, lactose cannot cross the bacterial cell membrane without the help of the Permease protein channel, which is coded by the lacY gene in the Lac Operon. So, it appears that we have a case of "what's first, the chicken or the egg?" - how can lactose enter the cell...

  • 4. Nutritional status, mutation, and expression of the lac operon. For each of the following conditions,...

    4. Nutritional status, mutation, and expression of the lac operon. For each of the following conditions, indicate how much (a lot, a little, or none) of the lacZ gene (z-gene) product, beta- galactosidase, is being synthesized. NUTRITIONAL STATUS OF THE BACTERIA +lactose/-glucose +lactose/+glucose -lactose/+glucose genetic status normal (no mutation) mutation a mutation b mutationc important: these are nor the same mutations as the ones in your class handout mutation a: a mutation in the start codon for the lacA (A-gene)...

  • An enzyme, encoded by gene A, converts substrate X into product Y. Individuals with a dominant...

    An enzyme, encoded by gene A, converts substrate X into product Y. Individuals with a dominant mutation in gene A over accumulate substrate X, which causes severe neurological symptoms. At the molecular level, this enzyme functions as a homodimer. A homodimer is a protein composed of two subunits that are encoded by the same gene. Let’s suppose you are able to purify subunits from cell samples and then mix them together under conditions in which they form homodimers, and you...

  • 13. Protein B regulates ubiquitination of the protein encoded by gene A If the level of...

    13. Protein B regulates ubiquitination of the protein encoded by gene A If the level of protein B changes, what else do we expect to change (please answer yes/no for each)? Transcription of gene A? Splicing of gene A? Rate of translation of RNA copies of gene A? Overall level of protein A in the cell? yes 14. Imagine that a protein regulates a gene. Given that it regulates the other gene at the following levels, circle all that will...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT